FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628226_at:

>probe:Drosophila_2:1628226_at:444:271; Interrogation_Position=1008; Antisense; CATTTGGCTGAAGAGTCCTGGACGG
>probe:Drosophila_2:1628226_at:213:205; Interrogation_Position=1039; Antisense; AAGCGTTTGCCGAGAAGACCATTGA
>probe:Drosophila_2:1628226_at:403:423; Interrogation_Position=1062; Antisense; GAGAAATATCCTCCATCCAGGGTGA
>probe:Drosophila_2:1628226_at:281:531; Interrogation_Position=1082; Antisense; GGTGATTTCTTATAACCCAATGGTT
>probe:Drosophila_2:1628226_at:102:299; Interrogation_Position=1121; Antisense; CGCTGCAACACGAAATTTGGGCTTT
>probe:Drosophila_2:1628226_at:248:189; Interrogation_Position=1160; Antisense; AACAGTTTGCCTCTTCTTTACATAT
>probe:Drosophila_2:1628226_at:444:701; Interrogation_Position=1203; Antisense; TTTTAAGCCAAACTGCCTAGATTAG
>probe:Drosophila_2:1628226_at:548:537; Interrogation_Position=737; Antisense; GGTCTTCTATCCTTGGGTCTACGAT
>probe:Drosophila_2:1628226_at:611:361; Interrogation_Position=820; Antisense; GAATTTTGCAAAGCACGGGCACCTT
>probe:Drosophila_2:1628226_at:594:689; Interrogation_Position=882; Antisense; TTTGGTGGCACCAGCATGGACTACG
>probe:Drosophila_2:1628226_at:355:67; Interrogation_Position=897; Antisense; ATGGACTACGCACTGCTTGCAGGAT
>probe:Drosophila_2:1628226_at:15:461; Interrogation_Position=919; Antisense; GATTTCCACTATCCTTTGTGTTCGA
>probe:Drosophila_2:1628226_at:287:587; Interrogation_Position=970; Antisense; TGGAGTACAAGTTCTTTCCTCCGGC
>probe:Drosophila_2:1628226_at:428:629; Interrogation_Position=986; Antisense; TCCTCCGGCCAGAGATATACGGCAT

Paste this into a BLAST search page for me
CATTTGGCTGAAGAGTCCTGGACGGAAGCGTTTGCCGAGAAGACCATTGAGAGAAATATCCTCCATCCAGGGTGAGGTGATTTCTTATAACCCAATGGTTCGCTGCAACACGAAATTTGGGCTTTAACAGTTTGCCTCTTCTTTACATATTTTTAAGCCAAACTGCCTAGATTAGGGTCTTCTATCCTTGGGTCTACGATGAATTTTGCAAAGCACGGGCACCTTTTTGGTGGCACCAGCATGGACTACGATGGACTACGCACTGCTTGCAGGATGATTTCCACTATCCTTTGTGTTCGATGGAGTACAAGTTCTTTCCTCCGGCTCCTCCGGCCAGAGATATACGGCAT

Full Affymetrix probeset data:

Annotations for 1628226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720