FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628228_at:

>probe:Drosophila_2:1628228_at:79:13; Interrogation_Position=402; Antisense; ATTCAGCGCTTTGAAGATCTGCGGA
>probe:Drosophila_2:1628228_at:159:71; Interrogation_Position=436; Antisense; AGGAGTTTGGCGATCTTCCCGAGGT
>probe:Drosophila_2:1628228_at:453:605; Interrogation_Position=472; Antisense; TGATCAACGTGGATGTGCGCCGCAT
>probe:Drosophila_2:1628228_at:725:109; Interrogation_Position=524; Antisense; AGAAGGTCATGTTCTCCAGCAATCC
>probe:Drosophila_2:1628228_at:346:111; Interrogation_Position=541; Antisense; AGCAATCCTGGTTTCTGCTCAAGAA
>probe:Drosophila_2:1628228_at:223:87; Interrogation_Position=565; Antisense; AGTCCACGGAGAGTTGTGCTCGGTT
>probe:Drosophila_2:1628228_at:678:435; Interrogation_Position=615; Antisense; GAGGATCGTCCTCCATTGAAGACCA
>probe:Drosophila_2:1628228_at:713:373; Interrogation_Position=632; Antisense; GAAGACCAACTCTGGTATCGTTGAG
>probe:Drosophila_2:1628228_at:559:435; Interrogation_Position=687; Antisense; GAGGTAGCTGAAACACCGCGGGTTA
>probe:Drosophila_2:1628228_at:65:165; Interrogation_Position=720; Antisense; AAATCGCTGCTCTCGAATATGGTTA
>probe:Drosophila_2:1628228_at:327:695; Interrogation_Position=812; Antisense; TTTCCAGGACTATGGTCATGCGCGC
>probe:Drosophila_2:1628228_at:552:617; Interrogation_Position=850; Antisense; TGCAGTTGATCATACGCGTTCTTCG
>probe:Drosophila_2:1628228_at:115:107; Interrogation_Position=904; Antisense; AGAAAATTCCAGCTCACAACGCCAA
>probe:Drosophila_2:1628228_at:488:627; Interrogation_Position=952; Antisense; TGCCACCGAAGAGGAAGCCCATCTA

Paste this into a BLAST search page for me
ATTCAGCGCTTTGAAGATCTGCGGAAGGAGTTTGGCGATCTTCCCGAGGTTGATCAACGTGGATGTGCGCCGCATAGAAGGTCATGTTCTCCAGCAATCCAGCAATCCTGGTTTCTGCTCAAGAAAGTCCACGGAGAGTTGTGCTCGGTTGAGGATCGTCCTCCATTGAAGACCAGAAGACCAACTCTGGTATCGTTGAGGAGGTAGCTGAAACACCGCGGGTTAAAATCGCTGCTCTCGAATATGGTTATTTCCAGGACTATGGTCATGCGCGCTGCAGTTGATCATACGCGTTCTTCGAGAAAATTCCAGCTCACAACGCCAATGCCACCGAAGAGGAAGCCCATCTA

Full Affymetrix probeset data:

Annotations for 1628228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720