FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628229_at:

>probe:Drosophila_2:1628229_at:302:95; Interrogation_Position=1023; Antisense; AGATTCTGCGTCTGCCCTACAAGGG
>probe:Drosophila_2:1628229_at:422:369; Interrogation_Position=1084; Antisense; GAATGGCATCCATGACTTGGTCAAG
>probe:Drosophila_2:1628229_at:632:663; Interrogation_Position=1128; Antisense; TAAAGAGCGCTCAGTGGGCCATGGA
>probe:Drosophila_2:1628229_at:650:207; Interrogation_Position=1161; Antisense; AAGTGAAGGTGACGCTGCCCAAGTT
>probe:Drosophila_2:1628229_at:95:93; Interrogation_Position=1182; Antisense; AGTTCCATTTCGACTACCAGCAGAA
>probe:Drosophila_2:1628229_at:604:201; Interrogation_Position=1205; Antisense; AACCTTAAGGAGACGTTGCGCAGCC
>probe:Drosophila_2:1628229_at:592:261; Interrogation_Position=1225; Antisense; CAGCCTGGGTGTGCGCGAAATCTTT
>probe:Drosophila_2:1628229_at:544:661; Interrogation_Position=1315; Antisense; TAACATCCTGCAGAAGGCCGGCATT
>probe:Drosophila_2:1628229_at:720:671; Interrogation_Position=1367; Antisense; TACGCAGCCACCGTTGTGGAGATCG
>probe:Drosophila_2:1628229_at:119:113; Interrogation_Position=1409; Antisense; AGCACCGCCATCGAGGAATTCAACG
>probe:Drosophila_2:1628229_at:219:579; Interrogation_Position=1440; Antisense; GGCCGTTTGTGTTCTTTATCGAGGA
>probe:Drosophila_2:1628229_at:4:551; Interrogation_Position=1465; Antisense; GGAGTCCACTGGTAACATACTGTTT
>probe:Drosophila_2:1628229_at:174:317; Interrogation_Position=1526; Antisense; GCCTCTCAGGCGGTTTTATCTTTAA
>probe:Drosophila_2:1628229_at:120:663; Interrogation_Position=992; Antisense; TACTACACCACCTCGGAGAAGCTGA

Paste this into a BLAST search page for me
AGATTCTGCGTCTGCCCTACAAGGGGAATGGCATCCATGACTTGGTCAAGTAAAGAGCGCTCAGTGGGCCATGGAAAGTGAAGGTGACGCTGCCCAAGTTAGTTCCATTTCGACTACCAGCAGAAAACCTTAAGGAGACGTTGCGCAGCCCAGCCTGGGTGTGCGCGAAATCTTTTAACATCCTGCAGAAGGCCGGCATTTACGCAGCCACCGTTGTGGAGATCGAGCACCGCCATCGAGGAATTCAACGGGCCGTTTGTGTTCTTTATCGAGGAGGAGTCCACTGGTAACATACTGTTTGCCTCTCAGGCGGTTTTATCTTTAATACTACACCACCTCGGAGAAGCTGA

Full Affymetrix probeset data:

Annotations for 1628229_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720