FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628231_at:

>probe:Drosophila_2:1628231_at:5:485; Interrogation_Position=4761; Antisense; GTATCTGCTCGTTTTCATTCTTATC
>probe:Drosophila_2:1628231_at:724:403; Interrogation_Position=4789; Antisense; GACTCTTAAGATCTATTTCCCTCTC
>probe:Drosophila_2:1628231_at:306:641; Interrogation_Position=4810; Antisense; TCTCCACTGCGAACAGCAAACACTA
>probe:Drosophila_2:1628231_at:122:663; Interrogation_Position=4928; Antisense; TACTCGGATGTTTTTTACTACTACT
>probe:Drosophila_2:1628231_at:71:193; Interrogation_Position=4954; Antisense; AACTATTCACTACTTCATCTTTTGA
>probe:Drosophila_2:1628231_at:17:393; Interrogation_Position=5006; Antisense; GAAAGCCACCAAAGCGAACTACTCT
>probe:Drosophila_2:1628231_at:543:37; Interrogation_Position=5040; Antisense; ATCTATGAGTACCTATCGCATCCCA
>probe:Drosophila_2:1628231_at:253:175; Interrogation_Position=5067; Antisense; AAACCACTCGATACAATACCTCCGA
>probe:Drosophila_2:1628231_at:286:241; Interrogation_Position=5081; Antisense; AATACCTCCGATGAAAACTCACCTG
>probe:Drosophila_2:1628231_at:209:179; Interrogation_Position=5095; Antisense; AAACTCACCTGCTTAGATGCGATAT
>probe:Drosophila_2:1628231_at:580:327; Interrogation_Position=5113; Antisense; GCGATATTATCAACCAAACTCTCAA
>probe:Drosophila_2:1628231_at:247:19; Interrogation_Position=5150; Antisense; ATTTCGAAGTATCTGCGCTGGAGGA
>probe:Drosophila_2:1628231_at:311:475; Interrogation_Position=5199; Antisense; GTTAACACACTAAACACGCTGCAGT
>probe:Drosophila_2:1628231_at:51:189; Interrogation_Position=5211; Antisense; AACACGCTGCAGTAGATTCATTGAA

Paste this into a BLAST search page for me
GTATCTGCTCGTTTTCATTCTTATCGACTCTTAAGATCTATTTCCCTCTCTCTCCACTGCGAACAGCAAACACTATACTCGGATGTTTTTTACTACTACTAACTATTCACTACTTCATCTTTTGAGAAAGCCACCAAAGCGAACTACTCTATCTATGAGTACCTATCGCATCCCAAAACCACTCGATACAATACCTCCGAAATACCTCCGATGAAAACTCACCTGAAACTCACCTGCTTAGATGCGATATGCGATATTATCAACCAAACTCTCAAATTTCGAAGTATCTGCGCTGGAGGAGTTAACACACTAAACACGCTGCAGTAACACGCTGCAGTAGATTCATTGAA

Full Affymetrix probeset data:

Annotations for 1628231_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720