FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628232_at:

>probe:Drosophila_2:1628232_at:548:295; Interrogation_Position=2056; Antisense; CGAACCACGTGGTCTGGGCAGTCAC
>probe:Drosophila_2:1628232_at:235:383; Interrogation_Position=2110; Antisense; GAACGTGCTCCTTGGCATCGTCAAA
>probe:Drosophila_2:1628232_at:720:489; Interrogation_Position=2129; Antisense; GTCAAAGGCCCTCCAACAAATACGG
>probe:Drosophila_2:1628232_at:332:29; Interrogation_Position=2148; Antisense; ATACGGCTCAATCGTAGAGGCGCCC
>probe:Drosophila_2:1628232_at:693:429; Interrogation_Position=2164; Antisense; GAGGCGCCCGAAATGGTTTCGCCAA
>probe:Drosophila_2:1628232_at:17:363; Interrogation_Position=2219; Antisense; GCAATCCGGACATGTATACACCTGG
>probe:Drosophila_2:1628232_at:300:341; Interrogation_Position=2276; Antisense; GCTTCCAAATGGTTCAGACGGCTCA
>probe:Drosophila_2:1628232_at:381:453; Interrogation_Position=2314; Antisense; GATCAAACTATTACGGGTCACTTTT
>probe:Drosophila_2:1628232_at:517:729; Interrogation_Position=2337; Antisense; TTGGTTCTACAACTTCTGTGCGGAT
>probe:Drosophila_2:1628232_at:609:57; Interrogation_Position=2360; Antisense; ATGAGTGCATGCTGTATGCCGCGGA
>probe:Drosophila_2:1628232_at:243:51; Interrogation_Position=2375; Antisense; ATGCCGCGGATCAGTGCGATCGGAA
>probe:Drosophila_2:1628232_at:605:75; Interrogation_Position=2468; Antisense; AGGAGCACACCAATTCGCCACAGTG
>probe:Drosophila_2:1628232_at:429:327; Interrogation_Position=2492; Antisense; GCGAGGATTTCCGTGCCATTTGGCA
>probe:Drosophila_2:1628232_at:284:71; Interrogation_Position=2560; Antisense; AGGCGCAACTATGGCGATTCCAGAT

Paste this into a BLAST search page for me
CGAACCACGTGGTCTGGGCAGTCACGAACGTGCTCCTTGGCATCGTCAAAGTCAAAGGCCCTCCAACAAATACGGATACGGCTCAATCGTAGAGGCGCCCGAGGCGCCCGAAATGGTTTCGCCAAGCAATCCGGACATGTATACACCTGGGCTTCCAAATGGTTCAGACGGCTCAGATCAAACTATTACGGGTCACTTTTTTGGTTCTACAACTTCTGTGCGGATATGAGTGCATGCTGTATGCCGCGGAATGCCGCGGATCAGTGCGATCGGAAAGGAGCACACCAATTCGCCACAGTGGCGAGGATTTCCGTGCCATTTGGCAAGGCGCAACTATGGCGATTCCAGAT

Full Affymetrix probeset data:

Annotations for 1628232_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720