FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628234_at:

>probe:Drosophila_2:1628234_at:23:583; Interrogation_Position=125; Antisense; TGGCCGCCACGGATAATGATATTAC
>probe:Drosophila_2:1628234_at:524:91; Interrogation_Position=197; Antisense; AGTATCCTGGATGTGTGCCCAAGCC
>probe:Drosophila_2:1628234_at:493:531; Interrogation_Position=243; Antisense; GGGTCGCTGTGCCAGTTATATCCAG
>probe:Drosophila_2:1628234_at:713:475; Interrogation_Position=257; Antisense; GTTATATCCAGGTTTCGGGCAGTAA
>probe:Drosophila_2:1628234_at:412:169; Interrogation_Position=290; Antisense; AAATGGAGCGTTCCTGCATGTGCTG
>probe:Drosophila_2:1628234_at:636:641; Interrogation_Position=344; Antisense; TCTCGCTATTCTGTCCCAAAGTGAA
>probe:Drosophila_2:1628234_at:92:379; Interrogation_Position=366; Antisense; GAAGCCCGGCGAGCGTAAATTCAAG
>probe:Drosophila_2:1628234_at:581:307; Interrogation_Position=409; Antisense; CCATTGGAGTGCATGTGTCGGCCAT
>probe:Drosophila_2:1628234_at:34:641; Interrogation_Position=426; Antisense; TCGGCCATGCACTTCCATTGAGGAG
>probe:Drosophila_2:1628234_at:324:437; Interrogation_Position=445; Antisense; GAGGAGTCTGGCATCATACCACAGG
>probe:Drosophila_2:1628234_at:531:27; Interrogation_Position=460; Antisense; ATACCACAGGAAATTGCCGGCTATT
>probe:Drosophila_2:1628234_at:7:547; Interrogation_Position=486; Antisense; GGACGAGGGTCCACTCAACAATCAC
>probe:Drosophila_2:1628234_at:687:143; Interrogation_Position=71; Antisense; ACTGCGTCCTGGTCAGCATTCTGAA
>probe:Drosophila_2:1628234_at:280:345; Interrogation_Position=86; Antisense; GCATTCTGAAACTCTGCACGGCACA

Paste this into a BLAST search page for me
TGGCCGCCACGGATAATGATATTACAGTATCCTGGATGTGTGCCCAAGCCGGGTCGCTGTGCCAGTTATATCCAGGTTATATCCAGGTTTCGGGCAGTAAAAATGGAGCGTTCCTGCATGTGCTGTCTCGCTATTCTGTCCCAAAGTGAAGAAGCCCGGCGAGCGTAAATTCAAGCCATTGGAGTGCATGTGTCGGCCATTCGGCCATGCACTTCCATTGAGGAGGAGGAGTCTGGCATCATACCACAGGATACCACAGGAAATTGCCGGCTATTGGACGAGGGTCCACTCAACAATCACACTGCGTCCTGGTCAGCATTCTGAAGCATTCTGAAACTCTGCACGGCACA

Full Affymetrix probeset data:

Annotations for 1628234_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720