FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628235_at:

>probe:Drosophila_2:1628235_at:127:213; Interrogation_Position=363; Antisense; AAGACCCGTGGAGCTGTCCATGTGG
>probe:Drosophila_2:1628235_at:665:63; Interrogation_Position=382; Antisense; ATGTGGCTCCTCTGCCAGGACATGT
>probe:Drosophila_2:1628235_at:449:87; Interrogation_Position=409; Antisense; AGTCCGCTGCTTCCGTGAACTTGGA
>probe:Drosophila_2:1628235_at:606:509; Interrogation_Position=423; Antisense; GTGAACTTGGAACCCGCACCAGGCA
>probe:Drosophila_2:1628235_at:713:71; Interrogation_Position=443; Antisense; AGGCACCTGGTAATCACCTGAAATG
>probe:Drosophila_2:1628235_at:477:393; Interrogation_Position=462; Antisense; GAAATGACTTCTGGATTACCCCTAC
>probe:Drosophila_2:1628235_at:580:589; Interrogation_Position=473; Antisense; TGGATTACCCCTACATTGATCCTGA
>probe:Drosophila_2:1628235_at:230:393; Interrogation_Position=547; Antisense; GAAAGGTCTGTCCTCTGCTGAGATC
>probe:Drosophila_2:1628235_at:253:621; Interrogation_Position=562; Antisense; TGCTGAGATCCCGTTGGGTTCTCAT
>probe:Drosophila_2:1628235_at:20:531; Interrogation_Position=577; Antisense; GGGTTCTCATTTCTTCAGCAATCTA
>probe:Drosophila_2:1628235_at:49:659; Interrogation_Position=600; Antisense; TAAGTCAATCCTATCCAGTCTATCG
>probe:Drosophila_2:1628235_at:232:629; Interrogation_Position=628; Antisense; TCCGCTTTACTCTCTGGTCTATATT
>probe:Drosophila_2:1628235_at:589:587; Interrogation_Position=642; Antisense; TGGTCTATATTTATCCACCCCGCTG
>probe:Drosophila_2:1628235_at:192:133; Interrogation_Position=658; Antisense; ACCCCGCTGTTGTCACATGGAAATT

Paste this into a BLAST search page for me
AAGACCCGTGGAGCTGTCCATGTGGATGTGGCTCCTCTGCCAGGACATGTAGTCCGCTGCTTCCGTGAACTTGGAGTGAACTTGGAACCCGCACCAGGCAAGGCACCTGGTAATCACCTGAAATGGAAATGACTTCTGGATTACCCCTACTGGATTACCCCTACATTGATCCTGAGAAAGGTCTGTCCTCTGCTGAGATCTGCTGAGATCCCGTTGGGTTCTCATGGGTTCTCATTTCTTCAGCAATCTATAAGTCAATCCTATCCAGTCTATCGTCCGCTTTACTCTCTGGTCTATATTTGGTCTATATTTATCCACCCCGCTGACCCCGCTGTTGTCACATGGAAATT

Full Affymetrix probeset data:

Annotations for 1628235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720