FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628236_at:

>probe:Drosophila_2:1628236_at:171:591; Interrogation_Position=1043; Antisense; TGGTCGAGTCCCACGAAAACTGTTT
>probe:Drosophila_2:1628236_at:654:473; Interrogation_Position=1080; Antisense; GTTAATTTATTTGATTCCACCTCTA
>probe:Drosophila_2:1628236_at:294:289; Interrogation_Position=614; Antisense; CGGTACTAAAGCCATTCGAAGCCAT
>probe:Drosophila_2:1628236_at:712:77; Interrogation_Position=644; Antisense; AGGATCTCCTCCAAATGTACGACGA
>probe:Drosophila_2:1628236_at:504:487; Interrogation_Position=660; Antisense; GTACGACGATGCCATCCAACTAGAA
>probe:Drosophila_2:1628236_at:284:63; Interrogation_Position=709; Antisense; ATGTGGCAGAACATTCCCCTAGACT
>probe:Drosophila_2:1628236_at:517:677; Interrogation_Position=728; Antisense; TAGACTCGCTGGTCTTCATGCAGGA
>probe:Drosophila_2:1628236_at:231:623; Interrogation_Position=766; Antisense; TGCGAACGCGATGCCACCGGATTGT
>probe:Drosophila_2:1628236_at:225:283; Interrogation_Position=816; Antisense; CTCCAAGGATGGCAGTGGTTCTCTG
>probe:Drosophila_2:1628236_at:253:457; Interrogation_Position=881; Antisense; GATACCGAGTGAGATCCCAGCACGT
>probe:Drosophila_2:1628236_at:13:449; Interrogation_Position=893; Antisense; GATCCCAGCACGTGAGAACCGAGAG
>probe:Drosophila_2:1628236_at:251:543; Interrogation_Position=943; Antisense; GGATTCCGACTCCAGTGCGATGTGT
>probe:Drosophila_2:1628236_at:542:623; Interrogation_Position=958; Antisense; TGCGATGTGTGCGTCCAGCTGGAAA
>probe:Drosophila_2:1628236_at:192:567; Interrogation_Position=983; Antisense; GGCAGTACTCCTGCTACTAAATGGA

Paste this into a BLAST search page for me
TGGTCGAGTCCCACGAAAACTGTTTGTTAATTTATTTGATTCCACCTCTACGGTACTAAAGCCATTCGAAGCCATAGGATCTCCTCCAAATGTACGACGAGTACGACGATGCCATCCAACTAGAAATGTGGCAGAACATTCCCCTAGACTTAGACTCGCTGGTCTTCATGCAGGATGCGAACGCGATGCCACCGGATTGTCTCCAAGGATGGCAGTGGTTCTCTGGATACCGAGTGAGATCCCAGCACGTGATCCCAGCACGTGAGAACCGAGAGGGATTCCGACTCCAGTGCGATGTGTTGCGATGTGTGCGTCCAGCTGGAAAGGCAGTACTCCTGCTACTAAATGGA

Full Affymetrix probeset data:

Annotations for 1628236_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720