FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628238_at:

>probe:Drosophila_2:1628238_at:125:49; Interrogation_Position=1024; Antisense; ATCCATCAGGTGCAGCGCAACATGA
>probe:Drosophila_2:1628238_at:362:253; Interrogation_Position=1074; Antisense; CAAGCAGCGGGCCATTACACTGTGC
>probe:Drosophila_2:1628238_at:722:579; Interrogation_Position=1131; Antisense; TGGCCTGGAGCTGACCTGCGACATG
>probe:Drosophila_2:1628238_at:357:267; Interrogation_Position=1152; Antisense; CATGGTCCAGGATGCGCTTTACAAC
>probe:Drosophila_2:1628238_at:268:341; Interrogation_Position=1167; Antisense; GCTTTACAACGAACTGCAGGCGCTG
>probe:Drosophila_2:1628238_at:389:71; Interrogation_Position=1184; Antisense; AGGCGCTGAAGGCATCCGTATGCAA
>probe:Drosophila_2:1628238_at:541:387; Interrogation_Position=1230; Antisense; GAACAAGGCATCCATGCGCTACCTG
>probe:Drosophila_2:1628238_at:152:267; Interrogation_Position=1342; Antisense; CAGGCCCTGAAGTACCAAACATTTT
>probe:Drosophila_2:1628238_at:721:677; Interrogation_Position=1366; Antisense; TAGTCGGGCAGCACTACATCCAGTA
>probe:Drosophila_2:1628238_at:6:91; Interrogation_Position=1387; Antisense; AGTACAGCACCAGTCCAGTAGTCGC
>probe:Drosophila_2:1628238_at:567:51; Interrogation_Position=1457; Antisense; ATGCATGTGCATTTCGTGTTCGATC
>probe:Drosophila_2:1628238_at:304:713; Interrogation_Position=1469; Antisense; TTCGTGTTCGATCCCAAATTACTTA
>probe:Drosophila_2:1628238_at:126:645; Interrogation_Position=1506; Antisense; TCACTTTCGATTTCCAGTTACCAAA
>probe:Drosophila_2:1628238_at:358:263; Interrogation_Position=933; Antisense; CAGGACCAACGAGGCCTTTGAGCGA

Paste this into a BLAST search page for me
ATCCATCAGGTGCAGCGCAACATGACAAGCAGCGGGCCATTACACTGTGCTGGCCTGGAGCTGACCTGCGACATGCATGGTCCAGGATGCGCTTTACAACGCTTTACAACGAACTGCAGGCGCTGAGGCGCTGAAGGCATCCGTATGCAAGAACAAGGCATCCATGCGCTACCTGCAGGCCCTGAAGTACCAAACATTTTTAGTCGGGCAGCACTACATCCAGTAAGTACAGCACCAGTCCAGTAGTCGCATGCATGTGCATTTCGTGTTCGATCTTCGTGTTCGATCCCAAATTACTTATCACTTTCGATTTCCAGTTACCAAACAGGACCAACGAGGCCTTTGAGCGA

Full Affymetrix probeset data:

Annotations for 1628238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720