Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628240_at:

>probe:Drosophila_2:1628240_at:336:601; Interrogation_Position=1485; Antisense; TGATAGGTCGTCTCATTTTCATCGG
>probe:Drosophila_2:1628240_at:316:17; Interrogation_Position=1499; Antisense; ATTTTCATCGGTCTGTTTGTGGCGC
>probe:Drosophila_2:1628240_at:198:727; Interrogation_Position=1515; Antisense; TTGTGGCGCCTTCGGTTAGGCAATA
>probe:Drosophila_2:1628240_at:110:265; Interrogation_Position=1583; Antisense; CAGTGTTGGGTTTACGGCGCCATCA
>probe:Drosophila_2:1628240_at:255:65; Interrogation_Position=1607; Antisense; ATGGTCTCCGAAGCTATTCTGTGCA
>probe:Drosophila_2:1628240_at:279:251; Interrogation_Position=1642; Antisense; CAAGGAGTTGTTTGAGCGCACGCAA
>probe:Drosophila_2:1628240_at:479:135; Interrogation_Position=1661; Antisense; ACGCAAGCCATCAACATTGTCCTGT
>probe:Drosophila_2:1628240_at:161:505; Interrogation_Position=1679; Antisense; GTCCTGTGGCTGACTGTCCAAGTAA
>probe:Drosophila_2:1628240_at:205:241; Interrogation_Position=1702; Antisense; AATAATCTCGGTGGCATTTGTCTAC
>probe:Drosophila_2:1628240_at:536:671; Interrogation_Position=1724; Antisense; TACCTCGCGGTTTACTGGCAGCAGC
>probe:Drosophila_2:1628240_at:725:385; Interrogation_Position=1756; Antisense; GAAAAAGGTTTCATCGACGCCCGCA
>probe:Drosophila_2:1628240_at:338:173; Interrogation_Position=1787; Antisense; AAAGAAACTATTCCTGCCAGCTCAT
>probe:Drosophila_2:1628240_at:260:641; Interrogation_Position=1808; Antisense; TCATCATCGCCCTCGAAAGGTAAAT
>probe:Drosophila_2:1628240_at:597:589; Interrogation_Position=1905; Antisense; TGGATCGGGCCATTCTTTAAATTAA

Paste this into a BLAST search page for me
TGATAGGTCGTCTCATTTTCATCGGATTTTCATCGGTCTGTTTGTGGCGCTTGTGGCGCCTTCGGTTAGGCAATACAGTGTTGGGTTTACGGCGCCATCAATGGTCTCCGAAGCTATTCTGTGCACAAGGAGTTGTTTGAGCGCACGCAAACGCAAGCCATCAACATTGTCCTGTGTCCTGTGGCTGACTGTCCAAGTAAAATAATCTCGGTGGCATTTGTCTACTACCTCGCGGTTTACTGGCAGCAGCGAAAAAGGTTTCATCGACGCCCGCAAAAGAAACTATTCCTGCCAGCTCATTCATCATCGCCCTCGAAAGGTAAATTGGATCGGGCCATTCTTTAAATTAA

Full Affymetrix probeset data:

Annotations for 1628240_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime