Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628243_at:

>probe:Drosophila_2:1628243_at:469:317; Interrogation_Position=3463; Antisense; GACCCGTACTAGCAAAACGTTATCA
>probe:Drosophila_2:1628243_at:326:75; Interrogation_Position=3499; Antisense; AGGACCAACTTCTAAATCACATCAT
>probe:Drosophila_2:1628243_at:355:37; Interrogation_Position=3519; Antisense; ATCATAGCATGGGTACGCGCTCGAC
>probe:Drosophila_2:1628243_at:328:337; Interrogation_Position=3537; Antisense; GCTCGACACGACAGCGCTGAGATAT
>probe:Drosophila_2:1628243_at:496:667; Interrogation_Position=3613; Antisense; TACCTATTTTACGTCCCTCTAAGAT
>probe:Drosophila_2:1628243_at:434:501; Interrogation_Position=3625; Antisense; GTCCCTCTAAGATGCACATGTAATT
>probe:Drosophila_2:1628243_at:478:595; Interrogation_Position=3649; Antisense; TGTGTACAATGTATACTCCCATTTA
>probe:Drosophila_2:1628243_at:277:361; Interrogation_Position=3707; Antisense; GCAATGGCTGGAGTCTACACACGAA
>probe:Drosophila_2:1628243_at:634:165; Interrogation_Position=3802; Antisense; AAATCGATTAATTATTCAGCGCTTA
>probe:Drosophila_2:1628243_at:202:649; Interrogation_Position=3817; Antisense; TCAGCGCTTAAGTTTTCTTTTGGGT
>probe:Drosophila_2:1628243_at:279:385; Interrogation_Position=3850; Antisense; GAACATATAATGTACCTTCTGGTGT
>probe:Drosophila_2:1628243_at:617:485; Interrogation_Position=3861; Antisense; GTACCTTCTGGTGTATGTTAACATA
>probe:Drosophila_2:1628243_at:537:163; Interrogation_Position=3886; Antisense; AAATCCAGAATATGCCTTTAGACAG
>probe:Drosophila_2:1628243_at:306:589; Interrogation_Position=3931; Antisense; TGGTTTACAGTCTTGAATCTAAGCT

Paste this into a BLAST search page for me
GACCCGTACTAGCAAAACGTTATCAAGGACCAACTTCTAAATCACATCATATCATAGCATGGGTACGCGCTCGACGCTCGACACGACAGCGCTGAGATATTACCTATTTTACGTCCCTCTAAGATGTCCCTCTAAGATGCACATGTAATTTGTGTACAATGTATACTCCCATTTAGCAATGGCTGGAGTCTACACACGAAAAATCGATTAATTATTCAGCGCTTATCAGCGCTTAAGTTTTCTTTTGGGTGAACATATAATGTACCTTCTGGTGTGTACCTTCTGGTGTATGTTAACATAAAATCCAGAATATGCCTTTAGACAGTGGTTTACAGTCTTGAATCTAAGCT

Full Affymetrix probeset data:

Annotations for 1628243_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime