FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628246_at:

>probe:Drosophila_2:1628246_at:499:79; Interrogation_Position=145; Antisense; AGGGTCTGTCCAGCATCGGGCTGAT
>probe:Drosophila_2:1628246_at:219:177; Interrogation_Position=15; Antisense; AAACGTCCGCTGAAAAGCCTGGTGT
>probe:Drosophila_2:1628246_at:596:631; Interrogation_Position=177; Antisense; TCCGGGAACGAGGTGCTGCACTACA
>probe:Drosophila_2:1628246_at:560:501; Interrogation_Position=265; Antisense; GTCCGCCGTTGGGTTCGCTGAACTA
>probe:Drosophila_2:1628246_at:707:191; Interrogation_Position=285; Antisense; AACTATAGTGTGAGCACCTCGACGC
>probe:Drosophila_2:1628246_at:285:125; Interrogation_Position=337; Antisense; AGCCCATGGAGGTCAGTCTGCTGAG
>probe:Drosophila_2:1628246_at:434:87; Interrogation_Position=351; Antisense; AGTCTGCTGAGTCCGAACAATCCGT
>probe:Drosophila_2:1628246_at:165:235; Interrogation_Position=369; Antisense; AATCCGTCGGTGACGTCGTCGTTGA
>probe:Drosophila_2:1628246_at:94:637; Interrogation_Position=384; Antisense; TCGTCGTTGAGCGAGTACCGATTTC
>probe:Drosophila_2:1628246_at:604:457; Interrogation_Position=403; Antisense; GATTTCGCACCGGTCCAGAGATCGT
>probe:Drosophila_2:1628246_at:240:649; Interrogation_Position=427; Antisense; TCACCACCTCGAATCGCATACAGGA
>probe:Drosophila_2:1628246_at:1:311; Interrogation_Position=44; Antisense; GCCAGGATTTGCAAGCCCTTCGAAT
>probe:Drosophila_2:1628246_at:369:715; Interrogation_Position=62; Antisense; TTCGAATCGCCTGATGCAGCGCGAT
>probe:Drosophila_2:1628246_at:463:53; Interrogation_Position=75; Antisense; ATGCAGCGCGATTACCTCCGGGAAA

Paste this into a BLAST search page for me
AGGGTCTGTCCAGCATCGGGCTGATAAACGTCCGCTGAAAAGCCTGGTGTTCCGGGAACGAGGTGCTGCACTACAGTCCGCCGTTGGGTTCGCTGAACTAAACTATAGTGTGAGCACCTCGACGCAGCCCATGGAGGTCAGTCTGCTGAGAGTCTGCTGAGTCCGAACAATCCGTAATCCGTCGGTGACGTCGTCGTTGATCGTCGTTGAGCGAGTACCGATTTCGATTTCGCACCGGTCCAGAGATCGTTCACCACCTCGAATCGCATACAGGAGCCAGGATTTGCAAGCCCTTCGAATTTCGAATCGCCTGATGCAGCGCGATATGCAGCGCGATTACCTCCGGGAAA

Full Affymetrix probeset data:

Annotations for 1628246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720