FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628247_at:

>probe:Drosophila_2:1628247_at:612:113; Interrogation_Position=357; Antisense; AGCAGCTGTGCAGATTTCTAGCCGA
>probe:Drosophila_2:1628247_at:326:573; Interrogation_Position=388; Antisense; GGCGCGAAAAAAGCGTCAGCGTTTC
>probe:Drosophila_2:1628247_at:74:123; Interrogation_Position=405; Antisense; AGCGTTTCAAGCTGCAGTACCAATG
>probe:Drosophila_2:1628247_at:525:485; Interrogation_Position=421; Antisense; GTACCAATGCAATCTGGCCATCGAT
>probe:Drosophila_2:1628247_at:105:67; Interrogation_Position=506; Antisense; ATGGACCTCGAGTTCATAGAGCAGC
>probe:Drosophila_2:1628247_at:24:595; Interrogation_Position=568; Antisense; TGGGCAGGCGCCACGTGATAGCATC
>probe:Drosophila_2:1628247_at:310:27; Interrogation_Position=585; Antisense; ATAGCATCCTGCTGAAGATTCGCCA
>probe:Drosophila_2:1628247_at:261:615; Interrogation_Position=597; Antisense; TGAAGATTCGCCACCAGATCTTCGA
>probe:Drosophila_2:1628247_at:198:1; Interrogation_Position=762; Antisense; AAATCCGGGAACTGAGACTAGTCTA
>probe:Drosophila_2:1628247_at:453:1; Interrogation_Position=784; Antisense; CTAAGGGTTAGCTTTAAGGACGCAT
>probe:Drosophila_2:1628247_at:320:555; Interrogation_Position=801; Antisense; GGACGCATTCGGTATTATTCCTGCT
>probe:Drosophila_2:1628247_at:476:9; Interrogation_Position=817; Antisense; ATTCCTGCTGCTGTGTGATGATCGC
>probe:Drosophila_2:1628247_at:290:607; Interrogation_Position=832; Antisense; TGATGATCGCGCTGCTCTTCCATTT
>probe:Drosophila_2:1628247_at:275:133; Interrogation_Position=861; Antisense; ACGCCTCTGCAAACCGACTTTATTT

Paste this into a BLAST search page for me
AGCAGCTGTGCAGATTTCTAGCCGAGGCGCGAAAAAAGCGTCAGCGTTTCAGCGTTTCAAGCTGCAGTACCAATGGTACCAATGCAATCTGGCCATCGATATGGACCTCGAGTTCATAGAGCAGCTGGGCAGGCGCCACGTGATAGCATCATAGCATCCTGCTGAAGATTCGCCATGAAGATTCGCCACCAGATCTTCGAAAATCCGGGAACTGAGACTAGTCTACTAAGGGTTAGCTTTAAGGACGCATGGACGCATTCGGTATTATTCCTGCTATTCCTGCTGCTGTGTGATGATCGCTGATGATCGCGCTGCTCTTCCATTTACGCCTCTGCAAACCGACTTTATTT

Full Affymetrix probeset data:

Annotations for 1628247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720