Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628248_at:

>probe:Drosophila_2:1628248_at:669:649; Interrogation_Position=3500; Antisense; TCAAATTTACCCAGTCAAAGGAGTG
>probe:Drosophila_2:1628248_at:72:521; Interrogation_Position=3522; Antisense; GTGGAGTATTCGTACACACACAATA
>probe:Drosophila_2:1628248_at:151:15; Interrogation_Position=3547; Antisense; ATTAGTTTATCCATCTATTTCGAAA
>probe:Drosophila_2:1628248_at:683:395; Interrogation_Position=3577; Antisense; GAAATAGTTCTCAATTGGACACAAA
>probe:Drosophila_2:1628248_at:543:695; Interrogation_Position=3614; Antisense; TTTCGAAAACTGGAGCTCGGCTACC
>probe:Drosophila_2:1628248_at:315:553; Interrogation_Position=3625; Antisense; GGAGCTCGGCTACCAAAATCGCAAT
>probe:Drosophila_2:1628248_at:539:181; Interrogation_Position=3677; Antisense; AAAACACGCACATTAGACACCAAAA
>probe:Drosophila_2:1628248_at:405:399; Interrogation_Position=3692; Antisense; GACACCAAAATCTATCCGACACAAA
>probe:Drosophila_2:1628248_at:205:681; Interrogation_Position=3802; Antisense; TATGTATCAATTGCGTTTCCTAACT
>probe:Drosophila_2:1628248_at:538:243; Interrogation_Position=3909; Antisense; AATTATTCACATGCAGTTAAGGTCA
>probe:Drosophila_2:1628248_at:294:687; Interrogation_Position=3942; Antisense; TATAAGAAACGCTTCCTTTCAAAGT
>probe:Drosophila_2:1628248_at:636:419; Interrogation_Position=3992; Antisense; GAGAGTAACATTCGGTCGTGTAAAA
>probe:Drosophila_2:1628248_at:542:217; Interrogation_Position=4026; Antisense; AAGTCTCATTATGTTAACCCAGCAT
>probe:Drosophila_2:1628248_at:57:709; Interrogation_Position=4039; Antisense; TTAACCCAGCATCCACTTACAAATA

Paste this into a BLAST search page for me
TCAAATTTACCCAGTCAAAGGAGTGGTGGAGTATTCGTACACACACAATAATTAGTTTATCCATCTATTTCGAAAGAAATAGTTCTCAATTGGACACAAATTTCGAAAACTGGAGCTCGGCTACCGGAGCTCGGCTACCAAAATCGCAATAAAACACGCACATTAGACACCAAAAGACACCAAAATCTATCCGACACAAATATGTATCAATTGCGTTTCCTAACTAATTATTCACATGCAGTTAAGGTCATATAAGAAACGCTTCCTTTCAAAGTGAGAGTAACATTCGGTCGTGTAAAAAAGTCTCATTATGTTAACCCAGCATTTAACCCAGCATCCACTTACAAATA

Full Affymetrix probeset data:

Annotations for 1628248_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime