FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628249_at:

>probe:Drosophila_2:1628249_at:356:479; Interrogation_Position=113; Antisense; GTTTCGAGGCACTGACGCGACACGA
>probe:Drosophila_2:1628249_at:560:583; Interrogation_Position=14; Antisense; TGGATAAACCCACAACTAGCGCCGC
>probe:Drosophila_2:1628249_at:204:249; Interrogation_Position=141; Antisense; CAATCTCAGTCGTTTGGCCACGAAA
>probe:Drosophila_2:1628249_at:210:551; Interrogation_Position=183; Antisense; GGAGTACATCACACACGAACTGAAC
>probe:Drosophila_2:1628249_at:557:383; Interrogation_Position=199; Antisense; GAACTGAACGCTCCGCTGGAGGATT
>probe:Drosophila_2:1628249_at:615:249; Interrogation_Position=246; Antisense; CAAGGCTACGATTGCCAAGTACAAG
>probe:Drosophila_2:1628249_at:537:251; Interrogation_Position=261; Antisense; CAAGTACAAGGACATGCGGCAGATT
>probe:Drosophila_2:1628249_at:471:149; Interrogation_Position=301; Antisense; ACTTCGACCAGTGAATTGAGCCTCA
>probe:Drosophila_2:1628249_at:169:609; Interrogation_Position=317; Antisense; TGAGCCTCAAGTTCCAGCAATTAGC
>probe:Drosophila_2:1628249_at:186:43; Interrogation_Position=358; Antisense; ATCGATGAGATTTCCGACACCGTCG
>probe:Drosophila_2:1628249_at:472:621; Interrogation_Position=39; Antisense; TGCTGCTGCGGCTCAGGATTCCAAC
>probe:Drosophila_2:1628249_at:154:333; Interrogation_Position=397; Antisense; GCGGCCTATAAACTGGACGCATACA
>probe:Drosophila_2:1628249_at:25:557; Interrogation_Position=411; Antisense; GGACGCATACAGCATAGCCCTAGAA
>probe:Drosophila_2:1628249_at:181:237; Interrogation_Position=436; Antisense; AATCGCGTCAAGTGCGTGCTGCAAA

Paste this into a BLAST search page for me
GTTTCGAGGCACTGACGCGACACGATGGATAAACCCACAACTAGCGCCGCCAATCTCAGTCGTTTGGCCACGAAAGGAGTACATCACACACGAACTGAACGAACTGAACGCTCCGCTGGAGGATTCAAGGCTACGATTGCCAAGTACAAGCAAGTACAAGGACATGCGGCAGATTACTTCGACCAGTGAATTGAGCCTCATGAGCCTCAAGTTCCAGCAATTAGCATCGATGAGATTTCCGACACCGTCGTGCTGCTGCGGCTCAGGATTCCAACGCGGCCTATAAACTGGACGCATACAGGACGCATACAGCATAGCCCTAGAAAATCGCGTCAAGTGCGTGCTGCAAA

Full Affymetrix probeset data:

Annotations for 1628249_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720