FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628251_at:

>probe:Drosophila_2:1628251_at:210:243; Interrogation_Position=131; Antisense; AATTCACTACTACAACTACGTAGCG
>probe:Drosophila_2:1628251_at:131:651; Interrogation_Position=134; Antisense; TCACTACTACAACTACGTAGCGCAT
>probe:Drosophila_2:1628251_at:260:79; Interrogation_Position=563; Antisense; AGCGGAGTCCTCGAGTACGTTTTTG
>probe:Drosophila_2:1628251_at:691:429; Interrogation_Position=567; Antisense; GAGTCCTCGAGTACGTTTTTGGCCA
>probe:Drosophila_2:1628251_at:220:501; Interrogation_Position=569; Antisense; GTCCTCGAGTACGTTTTTGGCCAAG
>probe:Drosophila_2:1628251_at:397:635; Interrogation_Position=573; Antisense; TCGAGTACGTTTTTGGCCAAGAGCC
>probe:Drosophila_2:1628251_at:384:671; Interrogation_Position=578; Antisense; TACGTTTTTGGCCAAGAGCCGCTGG
>probe:Drosophila_2:1628251_at:125:703; Interrogation_Position=583; Antisense; TTTTGGCCAAGAGCCGCTGGAGATT
>probe:Drosophila_2:1628251_at:153:299; Interrogation_Position=597; Antisense; CGCTGGAGATTGTTGTCTACAATTT
>probe:Drosophila_2:1628251_at:421:467; Interrogation_Position=608; Antisense; GTTGTCTACAATTTTGTGCCTCCAC
>probe:Drosophila_2:1628251_at:201:599; Interrogation_Position=610; Antisense; TGTCTACAATTTTGTGCCTCCACAG
>probe:Drosophila_2:1628251_at:14:279; Interrogation_Position=613; Antisense; CTACAATTTTGTGCCTCCACAGGGA
>probe:Drosophila_2:1628251_at:374:243; Interrogation_Position=617; Antisense; AATTTTGTGCCTCCACAGGGAAAAT
>probe:Drosophila_2:1628251_at:649:693; Interrogation_Position=619; Antisense; TTTTGTGCCTCCACAGGGAAAATAA

Paste this into a BLAST search page for me
AATTCACTACTACAACTACGTAGCGTCACTACTACAACTACGTAGCGCATAGCGGAGTCCTCGAGTACGTTTTTGGAGTCCTCGAGTACGTTTTTGGCCAGTCCTCGAGTACGTTTTTGGCCAAGTCGAGTACGTTTTTGGCCAAGAGCCTACGTTTTTGGCCAAGAGCCGCTGGTTTTGGCCAAGAGCCGCTGGAGATTCGCTGGAGATTGTTGTCTACAATTTGTTGTCTACAATTTTGTGCCTCCACTGTCTACAATTTTGTGCCTCCACAGCTACAATTTTGTGCCTCCACAGGGAAATTTTGTGCCTCCACAGGGAAAATTTTTGTGCCTCCACAGGGAAAATAA

Full Affymetrix probeset data:

Annotations for 1628251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720