FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628252_at:

>probe:Drosophila_2:1628252_at:600:295; Interrogation_Position=207; Antisense; CGAGCCGCCGAACCAGTTGTTAAAG
>probe:Drosophila_2:1628252_at:415:537; Interrogation_Position=231; Antisense; GGTCACGTACAGCAACAACCTGGTG
>probe:Drosophila_2:1628252_at:690:651; Interrogation_Position=275; Antisense; TAACGCCCACCCAGGTTAAGGATCA
>probe:Drosophila_2:1628252_at:648:133; Interrogation_Position=340; Antisense; ACGCTCATTATGACGGATCCCGATG
>probe:Drosophila_2:1628252_at:275:217; Interrogation_Position=385; Antisense; AAGTTCCGCGAGTTCAAGCACTGGA
>probe:Drosophila_2:1628252_at:357:209; Interrogation_Position=400; Antisense; AAGCACTGGATTCTGGCCAACATCG
>probe:Drosophila_2:1628252_at:202:45; Interrogation_Position=421; Antisense; ATCGCCGGCAACGACTTGGCAAGTG
>probe:Drosophila_2:1628252_at:644:221; Interrogation_Position=441; Antisense; AAGTGGTGAGCCCATCGCCGAGTAC
>probe:Drosophila_2:1628252_at:273:115; Interrogation_Position=524; Antisense; AGCAGTCCGGCAAACTTGAGTTCGA
>probe:Drosophila_2:1628252_at:554:223; Interrogation_Position=577; Antisense; AAGGATCGCCCCAAATTCAGTGCCG
>probe:Drosophila_2:1628252_at:154:311; Interrogation_Position=602; Antisense; CCAAGTTTGCCATCAATCACGAGTT
>probe:Drosophila_2:1628252_at:6:565; Interrogation_Position=628; Antisense; GGCAATCCCATTGCTGGAACTTTCT
>probe:Drosophila_2:1628252_at:579:583; Interrogation_Position=642; Antisense; TGGAACTTTCTACCAAGCCCAGTAC
>probe:Drosophila_2:1628252_at:302:489; Interrogation_Position=663; Antisense; GTACGACGACTATGTTCCAAAACTG

Paste this into a BLAST search page for me
CGAGCCGCCGAACCAGTTGTTAAAGGGTCACGTACAGCAACAACCTGGTGTAACGCCCACCCAGGTTAAGGATCAACGCTCATTATGACGGATCCCGATGAAGTTCCGCGAGTTCAAGCACTGGAAAGCACTGGATTCTGGCCAACATCGATCGCCGGCAACGACTTGGCAAGTGAAGTGGTGAGCCCATCGCCGAGTACAGCAGTCCGGCAAACTTGAGTTCGAAAGGATCGCCCCAAATTCAGTGCCGCCAAGTTTGCCATCAATCACGAGTTGGCAATCCCATTGCTGGAACTTTCTTGGAACTTTCTACCAAGCCCAGTACGTACGACGACTATGTTCCAAAACTG

Full Affymetrix probeset data:

Annotations for 1628252_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720