Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628256_at:

>probe:Drosophila_2:1628256_at:168:563; Interrogation_Position=1025; Antisense; GGAAGGCCCAAGCATTGATCCTCAA
>probe:Drosophila_2:1628256_at:268:609; Interrogation_Position=504; Antisense; TGAGCAGTCTTCAGCGTTCTAGTGA
>probe:Drosophila_2:1628256_at:617:657; Interrogation_Position=555; Antisense; TAAGTGGCTGCGCAGACACTTTCTT
>probe:Drosophila_2:1628256_at:222:337; Interrogation_Position=591; Antisense; GCTCCAATAGCTGCACTCCAAGAAA
>probe:Drosophila_2:1628256_at:502:387; Interrogation_Position=619; Antisense; GAACAAGTGTTCCAAGCCCAGGGTG
>probe:Drosophila_2:1628256_at:311:533; Interrogation_Position=640; Antisense; GGTGCGGAAGAGTTGCCCCAAACCA
>probe:Drosophila_2:1628256_at:506:387; Interrogation_Position=670; Antisense; GAAAACCTCGAAGCAACGTCGCAGT
>probe:Drosophila_2:1628256_at:728:349; Interrogation_Position=690; Antisense; GCAGTTGCGGCAAACCGAAGCCCAA
>probe:Drosophila_2:1628256_at:99:63; Interrogation_Position=736; Antisense; ATGTCCCCGCCCCAGGAAGAAGATG
>probe:Drosophila_2:1628256_at:341:515; Interrogation_Position=790; Antisense; GTGTCTTAAGCCCAAGAGCTCCAAG
>probe:Drosophila_2:1628256_at:277:629; Interrogation_Position=809; Antisense; TCCAAGCCCAAGTGCTCGATGTAAT
>probe:Drosophila_2:1628256_at:635:489; Interrogation_Position=829; Antisense; GTAATCGGAGGTTTCATCTTCCACA
>probe:Drosophila_2:1628256_at:330:665; Interrogation_Position=862; Antisense; TACACCACTTTTCGGCCATTTTTAT
>probe:Drosophila_2:1628256_at:652:437; Interrogation_Position=954; Antisense; GAGGAACCTCCAGTGAACCAGGAAA

Paste this into a BLAST search page for me
GGAAGGCCCAAGCATTGATCCTCAATGAGCAGTCTTCAGCGTTCTAGTGATAAGTGGCTGCGCAGACACTTTCTTGCTCCAATAGCTGCACTCCAAGAAAGAACAAGTGTTCCAAGCCCAGGGTGGGTGCGGAAGAGTTGCCCCAAACCAGAAAACCTCGAAGCAACGTCGCAGTGCAGTTGCGGCAAACCGAAGCCCAAATGTCCCCGCCCCAGGAAGAAGATGGTGTCTTAAGCCCAAGAGCTCCAAGTCCAAGCCCAAGTGCTCGATGTAATGTAATCGGAGGTTTCATCTTCCACATACACCACTTTTCGGCCATTTTTATGAGGAACCTCCAGTGAACCAGGAAA

Full Affymetrix probeset data:

Annotations for 1628256_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime