FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628258_at:

>probe:Drosophila_2:1628258_at:34:535; Interrogation_Position=1954; Antisense; GGTGCAATGATGCACATCCCAGTGT
>probe:Drosophila_2:1628258_at:212:151; Interrogation_Position=1967; Antisense; ACATCCCAGTGTGAAGGCACTTCAG
>probe:Drosophila_2:1628258_at:362:199; Interrogation_Position=1997; Antisense; AACCGACCAGCACATGCCCGGAAGA
>probe:Drosophila_2:1628258_at:40:153; Interrogation_Position=2008; Antisense; ACATGCCCGGAAGATTCCGCGTTAT
>probe:Drosophila_2:1628258_at:36:465; Interrogation_Position=2020; Antisense; GATTCCGCGTTATTGGATCTTTATC
>probe:Drosophila_2:1628258_at:393:471; Interrogation_Position=2057; Antisense; GTTCTCGAAGGAGTTCAACTGCCCA
>probe:Drosophila_2:1628258_at:66:225; Interrogation_Position=2064; Antisense; AAGGAGTTCAACTGCCCAGCCGGAT
>probe:Drosophila_2:1628258_at:207:45; Interrogation_Position=2087; Antisense; ATCCGCCATGAATCCTAGTGAGAAA
>probe:Drosophila_2:1628258_at:126:3; Interrogation_Position=2119; Antisense; TTTACTAGTTAGATTGACCCGAAAT
>probe:Drosophila_2:1628258_at:265:411; Interrogation_Position=2134; Antisense; GACCCGAAATGTCATTCCTCAGTTT
>probe:Drosophila_2:1628258_at:510:279; Interrogation_Position=2151; Antisense; CTCAGTTTGACCATGTTTACCCTAT
>probe:Drosophila_2:1628258_at:518:477; Interrogation_Position=2165; Antisense; GTTTACCCTATTTGGATTTGCTAAT
>probe:Drosophila_2:1628258_at:570:157; Interrogation_Position=2202; Antisense; AAAATTATAGTTTCGAGTAAGCGCG
>probe:Drosophila_2:1628258_at:71:659; Interrogation_Position=2219; Antisense; TAAGCGCGAAGAAATTTTGTTGACT

Paste this into a BLAST search page for me
GGTGCAATGATGCACATCCCAGTGTACATCCCAGTGTGAAGGCACTTCAGAACCGACCAGCACATGCCCGGAAGAACATGCCCGGAAGATTCCGCGTTATGATTCCGCGTTATTGGATCTTTATCGTTCTCGAAGGAGTTCAACTGCCCAAAGGAGTTCAACTGCCCAGCCGGATATCCGCCATGAATCCTAGTGAGAAATTTACTAGTTAGATTGACCCGAAATGACCCGAAATGTCATTCCTCAGTTTCTCAGTTTGACCATGTTTACCCTATGTTTACCCTATTTGGATTTGCTAATAAAATTATAGTTTCGAGTAAGCGCGTAAGCGCGAAGAAATTTTGTTGACT

Full Affymetrix probeset data:

Annotations for 1628258_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720