FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628260_at:

>probe:Drosophila_2:1628260_at:387:419; Interrogation_Position=109; Antisense; GAGCATTTCTCCAAGGATCGTTCCA
>probe:Drosophila_2:1628260_at:513:545; Interrogation_Position=123; Antisense; GGATCGTTCCATGATCTACATCGAG
>probe:Drosophila_2:1628260_at:317:139; Interrogation_Position=151; Antisense; ACGTACGAGTGTCCCATTTTCCAGA
>probe:Drosophila_2:1628260_at:294:15; Interrogation_Position=166; Antisense; ATTTTCCAGACCAAGGCCGACGAGT
>probe:Drosophila_2:1628260_at:307:289; Interrogation_Position=192; Antisense; CGGAACATTCTTCACGCAACGGATA
>probe:Drosophila_2:1628260_at:113:197; Interrogation_Position=209; Antisense; AACGGATACCGGAGCGCAAGTTCCA
>probe:Drosophila_2:1628260_at:498:671; Interrogation_Position=287; Antisense; TAGGGTTCTCGCAAAATGCACGCAC
>probe:Drosophila_2:1628260_at:505:655; Interrogation_Position=363; Antisense; TAAGTTCCCACTGGACTACGAGGCA
>probe:Drosophila_2:1628260_at:252:353; Interrogation_Position=385; Antisense; GCACTGGTGCCCGATGTGAACAGGA
>probe:Drosophila_2:1628260_at:161:243; Interrogation_Position=419; Antisense; AATTCTATCCCGACAAGGCGGTGGG
>probe:Drosophila_2:1628260_at:400:401; Interrogation_Position=478; Antisense; GACATGTAAACATTTGCCGCACTTT
>probe:Drosophila_2:1628260_at:247:319; Interrogation_Position=493; Antisense; GCCGCACTTTGTTGTCTGAATTATT
>probe:Drosophila_2:1628260_at:451:35; Interrogation_Position=568; Antisense; ATCAGCCAGAGACCTGTTGGAGCAA
>probe:Drosophila_2:1628260_at:176:585; Interrogation_Position=92; Antisense; TGGACTGGTCCTCCGATGAGCATTT

Paste this into a BLAST search page for me
GAGCATTTCTCCAAGGATCGTTCCAGGATCGTTCCATGATCTACATCGAGACGTACGAGTGTCCCATTTTCCAGAATTTTCCAGACCAAGGCCGACGAGTCGGAACATTCTTCACGCAACGGATAAACGGATACCGGAGCGCAAGTTCCATAGGGTTCTCGCAAAATGCACGCACTAAGTTCCCACTGGACTACGAGGCAGCACTGGTGCCCGATGTGAACAGGAAATTCTATCCCGACAAGGCGGTGGGGACATGTAAACATTTGCCGCACTTTGCCGCACTTTGTTGTCTGAATTATTATCAGCCAGAGACCTGTTGGAGCAATGGACTGGTCCTCCGATGAGCATTT

Full Affymetrix probeset data:

Annotations for 1628260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720