FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628261_at:

>probe:Drosophila_2:1628261_at:99:187; Interrogation_Position=14; Antisense; AACAGTTCACAACCAACCCAAACAG
>probe:Drosophila_2:1628261_at:549:681; Interrogation_Position=149; Antisense; TATGTGGCAGCTGCTCCTTACTCGG
>probe:Drosophila_2:1628261_at:312:675; Interrogation_Position=263; Antisense; TATGCCGCCTACTACCGTTAAGACT
>probe:Drosophila_2:1628261_at:646:545; Interrogation_Position=296; Antisense; GGATCGTGATCTTAACCTGACTGCT
>probe:Drosophila_2:1628261_at:434:283; Interrogation_Position=312; Antisense; CTGACTGCTGAACTGGACCTGAATA
>probe:Drosophila_2:1628261_at:664:271; Interrogation_Position=341; Antisense; CATATACACATCTATTGCAACAAGG
>probe:Drosophila_2:1628261_at:67:161; Interrogation_Position=360; Antisense; ACAAGGATACACACCTTCCTGCTAA
>probe:Drosophila_2:1628261_at:149:617; Interrogation_Position=390; Antisense; TGCAACATCCAATCTTCTTACATCC
>probe:Drosophila_2:1628261_at:441:707; Interrogation_Position=407; Antisense; TTACATCCCTGGTGTTAGTTCGACA
>probe:Drosophila_2:1628261_at:145:679; Interrogation_Position=422; Antisense; TAGTTCGACAGACTCTACATTTCCC
>probe:Drosophila_2:1628261_at:234:131; Interrogation_Position=448; Antisense; ACCTCTGCCGACTGCTGAAAGTTAA
>probe:Drosophila_2:1628261_at:362:603; Interrogation_Position=45; Antisense; TGTTCAAATACTTCGCTCTGTGCCT
>probe:Drosophila_2:1628261_at:473:527; Interrogation_Position=478; Antisense; GGGAACAGGACATACCACTTCAAGA
>probe:Drosophila_2:1628261_at:317:161; Interrogation_Position=525; Antisense; AAATACTGCATTTTGCGTAAAACGT

Paste this into a BLAST search page for me
AACAGTTCACAACCAACCCAAACAGTATGTGGCAGCTGCTCCTTACTCGGTATGCCGCCTACTACCGTTAAGACTGGATCGTGATCTTAACCTGACTGCTCTGACTGCTGAACTGGACCTGAATACATATACACATCTATTGCAACAAGGACAAGGATACACACCTTCCTGCTAATGCAACATCCAATCTTCTTACATCCTTACATCCCTGGTGTTAGTTCGACATAGTTCGACAGACTCTACATTTCCCACCTCTGCCGACTGCTGAAAGTTAATGTTCAAATACTTCGCTCTGTGCCTGGGAACAGGACATACCACTTCAAGAAAATACTGCATTTTGCGTAAAACGT

Full Affymetrix probeset data:

Annotations for 1628261_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720