FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628267_at:

>probe:Drosophila_2:1628267_at:331:95; Interrogation_Position=108; Antisense; AGTTGTGGCCCACAAAGCCGCAGAA
>probe:Drosophila_2:1628267_at:672:255; Interrogation_Position=120; Antisense; CAAAGCCGCAGAACTTAAGGTGTGT
>probe:Drosophila_2:1628267_at:551:61; Interrogation_Position=13; Antisense; ATGTCGCTGGAACTGGTACTCCAAC
>probe:Drosophila_2:1628267_at:726:657; Interrogation_Position=135; Antisense; TAAGGTGTGTGGCTACATCGCGCAT
>probe:Drosophila_2:1628267_at:409:345; Interrogation_Position=156; Antisense; GCATACGCACTGTGGCCGCAAAGTG
>probe:Drosophila_2:1628267_at:370:335; Interrogation_Position=200; Antisense; GCTCTGCTGGCCTGCAGATGATGGT
>probe:Drosophila_2:1628267_at:440:489; Interrogation_Position=28; Antisense; GTACTCCAACCGCAGCCAGAGATCT
>probe:Drosophila_2:1628267_at:707:443; Interrogation_Position=288; Antisense; GATGAAGGAGCCACGATTCTCGAAG
>probe:Drosophila_2:1628267_at:195:11; Interrogation_Position=303; Antisense; ATTCTCGAAGTGGAAGCTGCAATCA
>probe:Drosophila_2:1628267_at:368:29; Interrogation_Position=339; Antisense; ATACGATGTTTTCTTCTGTTGCTGA
>probe:Drosophila_2:1628267_at:78:313; Interrogation_Position=42; Antisense; GCCAGAGATCTACCTATTAGCGTAT
>probe:Drosophila_2:1628267_at:249:57; Interrogation_Position=70; Antisense; ATGAGTGTGCCCGAAGATTCCGATG
>probe:Drosophila_2:1628267_at:697:373; Interrogation_Position=82; Antisense; GAAGATTCCGATGAGGCCCTGCTTT
>probe:Drosophila_2:1628267_at:572:55; Interrogation_Position=92; Antisense; ATGAGGCCCTGCTTTCAGTTGTGGC

Paste this into a BLAST search page for me
AGTTGTGGCCCACAAAGCCGCAGAACAAAGCCGCAGAACTTAAGGTGTGTATGTCGCTGGAACTGGTACTCCAACTAAGGTGTGTGGCTACATCGCGCATGCATACGCACTGTGGCCGCAAAGTGGCTCTGCTGGCCTGCAGATGATGGTGTACTCCAACCGCAGCCAGAGATCTGATGAAGGAGCCACGATTCTCGAAGATTCTCGAAGTGGAAGCTGCAATCAATACGATGTTTTCTTCTGTTGCTGAGCCAGAGATCTACCTATTAGCGTATATGAGTGTGCCCGAAGATTCCGATGGAAGATTCCGATGAGGCCCTGCTTTATGAGGCCCTGCTTTCAGTTGTGGC

Full Affymetrix probeset data:

Annotations for 1628267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720