Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628268_at:

>probe:Drosophila_2:1628268_at:224:587; Interrogation_Position=1426; Antisense; TGGACATCGATTGGCCACCGAATGA
>probe:Drosophila_2:1628268_at:24:261; Interrogation_Position=1500; Antisense; CACCCCTACTGGACTCTTAGAGATA
>probe:Drosophila_2:1628268_at:600:677; Interrogation_Position=1517; Antisense; TAGAGATATCCTTGCATTTGTTACG
>probe:Drosophila_2:1628268_at:495:693; Interrogation_Position=1533; Antisense; TTTGTTACGCTCCTGGTGGTGATGA
>probe:Drosophila_2:1628268_at:569:365; Interrogation_Position=1571; Antisense; GAATCTCTACCACATCCTTGAGGAA
>probe:Drosophila_2:1628268_at:377:75; Interrogation_Position=1626; Antisense; AGGAGATCTCGTACCCTTGGGCAAA
>probe:Drosophila_2:1628268_at:706:373; Interrogation_Position=1701; Antisense; GAAGTATGAGCCTGGTCGACACTTT
>probe:Drosophila_2:1628268_at:153:637; Interrogation_Position=1716; Antisense; TCGACACTTTGGCTTACTCGCTTAT
>probe:Drosophila_2:1628268_at:572:683; Interrogation_Position=1738; Antisense; TATCCTTTCTCCGTTTCTCAAAACA
>probe:Drosophila_2:1628268_at:708:485; Interrogation_Position=1791; Antisense; GTAGCCAAGCTGTTCCGTAAGCCAA
>probe:Drosophila_2:1628268_at:360:27; Interrogation_Position=1839; Antisense; ATAGCGCTAGTCTTTGCTGTTGCTT
>probe:Drosophila_2:1628268_at:336:469; Interrogation_Position=1857; Antisense; GTTGCTTACCTACTTGTTTGCAGCT
>probe:Drosophila_2:1628268_at:483:619; Interrogation_Position=1888; Antisense; TGCTACCCTGTACTTATCACTTGAG
>probe:Drosophila_2:1628268_at:102:237; Interrogation_Position=1987; Antisense; AATCGCTCTTTTGGTTTCTAGACCT

Paste this into a BLAST search page for me
TGGACATCGATTGGCCACCGAATGACACCCCTACTGGACTCTTAGAGATATAGAGATATCCTTGCATTTGTTACGTTTGTTACGCTCCTGGTGGTGATGAGAATCTCTACCACATCCTTGAGGAAAGGAGATCTCGTACCCTTGGGCAAAGAAGTATGAGCCTGGTCGACACTTTTCGACACTTTGGCTTACTCGCTTATTATCCTTTCTCCGTTTCTCAAAACAGTAGCCAAGCTGTTCCGTAAGCCAAATAGCGCTAGTCTTTGCTGTTGCTTGTTGCTTACCTACTTGTTTGCAGCTTGCTACCCTGTACTTATCACTTGAGAATCGCTCTTTTGGTTTCTAGACCT

Full Affymetrix probeset data:

Annotations for 1628268_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime