FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628269_at:

>probe:Drosophila_2:1628269_at:138:69; Interrogation_Position=1213; Antisense; AGGCCGTGCGTCTGGGCAACTTGAA
>probe:Drosophila_2:1628269_at:379:189; Interrogation_Position=1230; Antisense; AACTTGAAGCGCTTCGGCGACGTGG
>probe:Drosophila_2:1628269_at:378:517; Interrogation_Position=1251; Antisense; GTGGTATCCCAATACGGACCCAAGT
>probe:Drosophila_2:1628269_at:487:587; Interrogation_Position=1282; Antisense; TGGACCACACATTCACCCTGATTAT
>probe:Drosophila_2:1628269_at:320:605; Interrogation_Position=1300; Antisense; TGATTATCCGGCTGCGCCACAATGT
>probe:Drosophila_2:1628269_at:698:229; Interrogation_Position=1320; Antisense; AATGTGATCAAGACGGCAATCCGCT
>probe:Drosophila_2:1628269_at:393:41; Interrogation_Position=1347; Antisense; ATCGGACTATCGTACTCACGCATCT
>probe:Drosophila_2:1628269_at:306:571; Interrogation_Position=1393; Antisense; GGCTAATGCTAGACTCCGCGGAGGA
>probe:Drosophila_2:1628269_at:192:103; Interrogation_Position=1432; Antisense; TATCGAAGGCTATACGGGACGGCGT
>probe:Drosophila_2:1628269_at:463:489; Interrogation_Position=1455; Antisense; GTGATTGAGGCTACGTTGGACCCAG
>probe:Drosophila_2:1628269_at:88:323; Interrogation_Position=1479; Antisense; GCCCAGAATTTCATGCGCAGCAAGG
>probe:Drosophila_2:1628269_at:391:393; Interrogation_Position=1503; Antisense; GAAAGTACGGACATCTACAGCACCC
>probe:Drosophila_2:1628269_at:2:381; Interrogation_Position=1571; Antisense; GAACCTGCACAACCAGAGCGTTAAG
>probe:Drosophila_2:1628269_at:166:77; Interrogation_Position=1708; Antisense; AGGATGGTTTCTAAGCGGCTGATTC

Paste this into a BLAST search page for me
AGGCCGTGCGTCTGGGCAACTTGAAAACTTGAAGCGCTTCGGCGACGTGGGTGGTATCCCAATACGGACCCAAGTTGGACCACACATTCACCCTGATTATTGATTATCCGGCTGCGCCACAATGTAATGTGATCAAGACGGCAATCCGCTATCGGACTATCGTACTCACGCATCTGGCTAATGCTAGACTCCGCGGAGGATATCGAAGGCTATACGGGACGGCGTGTGATTGAGGCTACGTTGGACCCAGGCCCAGAATTTCATGCGCAGCAAGGGAAAGTACGGACATCTACAGCACCCGAACCTGCACAACCAGAGCGTTAAGAGGATGGTTTCTAAGCGGCTGATTC

Full Affymetrix probeset data:

Annotations for 1628269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720