Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628271_at:

>probe:Drosophila_2:1628271_at:364:451; Interrogation_Position=1007; Antisense; GATCGAGGACACCATCCGCAAGCAG
>probe:Drosophila_2:1628271_at:116:711; Interrogation_Position=466; Antisense; TTAAGGAGCTCATCTCCAGCGGACA
>probe:Drosophila_2:1628271_at:504:517; Interrogation_Position=510; Antisense; GTGGAGGTCAACTTTGGCTTCCCTA
>probe:Drosophila_2:1628271_at:241:645; Interrogation_Position=539; Antisense; TCATGTCGACCGCTTGCAGAAACGC
>probe:Drosophila_2:1628271_at:364:595; Interrogation_Position=578; Antisense; TGTGGTCTACGATCTGGGCATTTAC
>probe:Drosophila_2:1628271_at:723:635; Interrogation_Position=615; Antisense; TCGCAGTGGGCCTTCCAGGAGAAAC
>probe:Drosophila_2:1628271_at:49:95; Interrogation_Position=646; Antisense; AGATCGAGTCCAAGGGAACCCTGAA
>probe:Drosophila_2:1628271_at:441:409; Interrogation_Position=684; Antisense; GACGATGATGTTAGTGCCACCTTGA
>probe:Drosophila_2:1628271_at:554:127; Interrogation_Position=702; Antisense; ACCTTGACCTACAGTGGTGGGCGCA
>probe:Drosophila_2:1628271_at:400:389; Interrogation_Position=763; Antisense; GAAACACCGCCGTTATCAAGGGCAC
>probe:Drosophila_2:1628271_at:605:91; Interrogation_Position=797; Antisense; AGTTACCCTGATTGACTTCTGGTCG
>probe:Drosophila_2:1628271_at:327:225; Interrogation_Position=872; Antisense; CAAGGGCAAGTACGCGACCAACTAC
>probe:Drosophila_2:1628271_at:194:193; Interrogation_Position=900; Antisense; AACTCCGAGGCCATGCGCTATGAGG
>probe:Drosophila_2:1628271_at:365:317; Interrogation_Position=984; Antisense; GCCGACAGTTTGATCTTCGCCGAGA

Paste this into a BLAST search page for me
GATCGAGGACACCATCCGCAAGCAGTTAAGGAGCTCATCTCCAGCGGACAGTGGAGGTCAACTTTGGCTTCCCTATCATGTCGACCGCTTGCAGAAACGCTGTGGTCTACGATCTGGGCATTTACTCGCAGTGGGCCTTCCAGGAGAAACAGATCGAGTCCAAGGGAACCCTGAAGACGATGATGTTAGTGCCACCTTGAACCTTGACCTACAGTGGTGGGCGCAGAAACACCGCCGTTATCAAGGGCACAGTTACCCTGATTGACTTCTGGTCGCAAGGGCAAGTACGCGACCAACTACAACTCCGAGGCCATGCGCTATGAGGGCCGACAGTTTGATCTTCGCCGAGA

Full Affymetrix probeset data:

Annotations for 1628271_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime