Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628274_a_at:

>probe:Drosophila_2:1628274_a_at:160:573; Interrogation_Position=175; Antisense; GGCTGCTCTAATCGTAAACACCTTC
>probe:Drosophila_2:1628274_a_at:361:625; Interrogation_Position=204; Antisense; TGCCCTTCAGCATGACGGAGTTTGA
>probe:Drosophila_2:1628274_a_at:88:73; Interrogation_Position=237; Antisense; AGGAACTTCAGTGTCGTGGCAAAAT
>probe:Drosophila_2:1628274_a_at:650:621; Interrogation_Position=297; Antisense; TGCTGCATCACCTCAAAGCGTTCAA
>probe:Drosophila_2:1628274_a_at:43:207; Interrogation_Position=312; Antisense; AAGCGTTCAACATTCCCATGGCTAT
>probe:Drosophila_2:1628274_a_at:50:69; Interrogation_Position=329; Antisense; ATGGCTATCGCAAGTGGCTGCTGTC
>probe:Drosophila_2:1628274_a_at:332:335; Interrogation_Position=345; Antisense; GCTGCTGTCGGGATTCGTTTAGGAT
>probe:Drosophila_2:1628274_a_at:192:455; Interrogation_Position=367; Antisense; GATAAAGACGCGTCGGCACTCCAGG
>probe:Drosophila_2:1628274_a_at:110:129; Interrogation_Position=408; Antisense; ACCACGTGGTTTTGAGCGGCTCCGA
>probe:Drosophila_2:1628274_a_at:661:421; Interrogation_Position=511; Antisense; GAGCAAGTGTCTGGTCTTCGAGTCC
>probe:Drosophila_2:1628274_a_at:292:641; Interrogation_Position=525; Antisense; TCTTCGAGTCCTCTTTGGTTGGTAT
>probe:Drosophila_2:1628274_a_at:290:449; Interrogation_Position=593; Antisense; GATCCTCTGGTATCCTTTCGAGCAA
>probe:Drosophila_2:1628274_a_at:208:405; Interrogation_Position=636; Antisense; GACTGCGATCGCTGGAAGGATTCAA
>probe:Drosophila_2:1628274_a_at:726:699; Interrogation_Position=670; Antisense; TTTTGGACTGCCACCTTTGTGAGAT

Paste this into a BLAST search page for me
GGCTGCTCTAATCGTAAACACCTTCTGCCCTTCAGCATGACGGAGTTTGAAGGAACTTCAGTGTCGTGGCAAAATTGCTGCATCACCTCAAAGCGTTCAAAAGCGTTCAACATTCCCATGGCTATATGGCTATCGCAAGTGGCTGCTGTCGCTGCTGTCGGGATTCGTTTAGGATGATAAAGACGCGTCGGCACTCCAGGACCACGTGGTTTTGAGCGGCTCCGAGAGCAAGTGTCTGGTCTTCGAGTCCTCTTCGAGTCCTCTTTGGTTGGTATGATCCTCTGGTATCCTTTCGAGCAAGACTGCGATCGCTGGAAGGATTCAATTTTGGACTGCCACCTTTGTGAGAT

Full Affymetrix probeset data:

Annotations for 1628274_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime