Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628275_at:

>probe:Drosophila_2:1628275_at:350:655; Interrogation_Position=3735; Antisense; TAATCACCTGTTTCAATTGCACACA
>probe:Drosophila_2:1628275_at:122:357; Interrogation_Position=3753; Antisense; GCACACATTTTGAGGATTGCCAATT
>probe:Drosophila_2:1628275_at:443:387; Interrogation_Position=3834; Antisense; GAAAACCATGTCTCAATTTGTATAT
>probe:Drosophila_2:1628275_at:27:165; Interrogation_Position=3974; Antisense; AAATACCGCTTCTAGATACTTGCTA
>probe:Drosophila_2:1628275_at:583:239; Interrogation_Position=4030; Antisense; AATAACCTTTGACGATCTATTCAAT
>probe:Drosophila_2:1628275_at:294:179; Interrogation_Position=4134; Antisense; AAACTTCGCACATAATACGCATGTA
>probe:Drosophila_2:1628275_at:347:483; Interrogation_Position=4156; Antisense; GTATCTATGGATCAATTCAACGCTG
>probe:Drosophila_2:1628275_at:692:649; Interrogation_Position=4172; Antisense; TCAACGCTGATTGTTCGAAAACTGT
>probe:Drosophila_2:1628275_at:651:141; Interrogation_Position=4192; Antisense; ACTGTTTGATAACGAGGGCCCTTTG
>probe:Drosophila_2:1628275_at:610:521; Interrogation_Position=4207; Antisense; GGGCCCTTTGGATTACATTGCGAAT
>probe:Drosophila_2:1628275_at:264:707; Interrogation_Position=4219; Antisense; TTACATTGCGAATAGACCGATGAGT
>probe:Drosophila_2:1628275_at:50:133; Interrogation_Position=4234; Antisense; ACCGATGAGTGTCTGTTCTGTAGGA
>probe:Drosophila_2:1628275_at:152:391; Interrogation_Position=4259; Antisense; GAAACATATTCATGCAACCCAGTAT
>probe:Drosophila_2:1628275_at:274:219; Interrogation_Position=4301; Antisense; AAGTGAGCCGGTTTGTGTACTGAAA

Paste this into a BLAST search page for me
TAATCACCTGTTTCAATTGCACACAGCACACATTTTGAGGATTGCCAATTGAAAACCATGTCTCAATTTGTATATAAATACCGCTTCTAGATACTTGCTAAATAACCTTTGACGATCTATTCAATAAACTTCGCACATAATACGCATGTAGTATCTATGGATCAATTCAACGCTGTCAACGCTGATTGTTCGAAAACTGTACTGTTTGATAACGAGGGCCCTTTGGGGCCCTTTGGATTACATTGCGAATTTACATTGCGAATAGACCGATGAGTACCGATGAGTGTCTGTTCTGTAGGAGAAACATATTCATGCAACCCAGTATAAGTGAGCCGGTTTGTGTACTGAAA

Full Affymetrix probeset data:

Annotations for 1628275_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime