FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628277_at:

>probe:Drosophila_2:1628277_at:384:89; Interrogation_Position=122; Antisense; AGTCTCAAAATGTCCCTCAATTGCC
>probe:Drosophila_2:1628277_at:360:707; Interrogation_Position=173; Antisense; TTAAACATTACCAGGTCCGCAACCT
>probe:Drosophila_2:1628277_at:5:297; Interrogation_Position=190; Antisense; CGCAACCTCGGATGACGTCAAGATC
>probe:Drosophila_2:1628277_at:5:63; Interrogation_Position=218; Antisense; ATGTGCGCCTGCTTGGAATTGGCCA
>probe:Drosophila_2:1628277_at:378:597; Interrogation_Position=245; Antisense; TGTCGGGCCGAAAACTGTCAGCTGA
>probe:Drosophila_2:1628277_at:67:441; Interrogation_Position=290; Antisense; GAGGCCAAGATCTGCAGTCTCGAAC
>probe:Drosophila_2:1628277_at:81:89; Interrogation_Position=305; Antisense; AGTCTCGAACAACTGGTGGCCACCA
>probe:Drosophila_2:1628277_at:451:553; Interrogation_Position=337; Antisense; GGAGCAGAACCAGATTCGCCAAGAA
>probe:Drosophila_2:1628277_at:575:703; Interrogation_Position=37; Antisense; TTCTGGGTGAACTTTCCGAGTACAA
>probe:Drosophila_2:1628277_at:498:379; Interrogation_Position=401; Antisense; GAAGCCGCCAACGAGGTGGATCCTT
>probe:Drosophila_2:1628277_at:103:545; Interrogation_Position=418; Antisense; GGATCCTTTGGACAACTCATTCGTG
>probe:Drosophila_2:1628277_at:9:369; Interrogation_Position=491; Antisense; GAATCCGAGTACAATGCTATCCAGT
>probe:Drosophila_2:1628277_at:561:29; Interrogation_Position=530; Antisense; ATACATTCTTCGATGGTCTCGCTGG
>probe:Drosophila_2:1628277_at:675:337; Interrogation_Position=558; Antisense; GCTCATTGAGTTTTTCATCCACCAG

Paste this into a BLAST search page for me
AGTCTCAAAATGTCCCTCAATTGCCTTAAACATTACCAGGTCCGCAACCTCGCAACCTCGGATGACGTCAAGATCATGTGCGCCTGCTTGGAATTGGCCATGTCGGGCCGAAAACTGTCAGCTGAGAGGCCAAGATCTGCAGTCTCGAACAGTCTCGAACAACTGGTGGCCACCAGGAGCAGAACCAGATTCGCCAAGAATTCTGGGTGAACTTTCCGAGTACAAGAAGCCGCCAACGAGGTGGATCCTTGGATCCTTTGGACAACTCATTCGTGGAATCCGAGTACAATGCTATCCAGTATACATTCTTCGATGGTCTCGCTGGGCTCATTGAGTTTTTCATCCACCAG

Full Affymetrix probeset data:

Annotations for 1628277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720