FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628278_at:

>probe:Drosophila_2:1628278_at:20:283; Interrogation_Position=1013; Antisense; CTGCGAGCAGCTTAGTGGTCCAATA
>probe:Drosophila_2:1628278_at:405:719; Interrogation_Position=1051; Antisense; TTCCCAGTGGCGCTAGAGTGCTACA
>probe:Drosophila_2:1628278_at:345:433; Interrogation_Position=1066; Antisense; GAGTGCTACAACTGGAGTCCCACGA
>probe:Drosophila_2:1628278_at:419:443; Interrogation_Position=1089; Antisense; GATGATGCCCTAATTGCCGTTGACA
>probe:Drosophila_2:1628278_at:374:417; Interrogation_Position=1197; Antisense; GAGCGATTGCTAGTGGCCGAACGTT
>probe:Drosophila_2:1628278_at:726:433; Interrogation_Position=1251; Antisense; GAGGGACTGCGGTTCTATCCAAATC
>probe:Drosophila_2:1628278_at:719:163; Interrogation_Position=1271; Antisense; AAATCTTCTGCTAGGCCGGGACTAA
>probe:Drosophila_2:1628278_at:281:623; Interrogation_Position=787; Antisense; TGCGTTTCAAATCCTACCTCATGAG
>probe:Drosophila_2:1628278_at:344:125; Interrogation_Position=873; Antisense; AGCCTGGCCCGACAGATTTGCGAAA
>probe:Drosophila_2:1628278_at:531:167; Interrogation_Position=895; Antisense; AAATGCTGCTGGATCCTATCGAGGA
>probe:Drosophila_2:1628278_at:645:347; Interrogation_Position=928; Antisense; GCATGATGTCCTTGGCTGATGTCTA
>probe:Drosophila_2:1628278_at:409:57; Interrogation_Position=946; Antisense; ATGTCTACTGTCGTGTAAACCGCGC
>probe:Drosophila_2:1628278_at:349:663; Interrogation_Position=961; Antisense; TAAACCGCGCTCGTGGTCTGGAACT
>probe:Drosophila_2:1628278_at:49:501; Interrogation_Position=976; Antisense; GTCTGGAACTGCTATCGCCTGAGGA

Paste this into a BLAST search page for me
CTGCGAGCAGCTTAGTGGTCCAATATTCCCAGTGGCGCTAGAGTGCTACAGAGTGCTACAACTGGAGTCCCACGAGATGATGCCCTAATTGCCGTTGACAGAGCGATTGCTAGTGGCCGAACGTTGAGGGACTGCGGTTCTATCCAAATCAAATCTTCTGCTAGGCCGGGACTAATGCGTTTCAAATCCTACCTCATGAGAGCCTGGCCCGACAGATTTGCGAAAAAATGCTGCTGGATCCTATCGAGGAGCATGATGTCCTTGGCTGATGTCTAATGTCTACTGTCGTGTAAACCGCGCTAAACCGCGCTCGTGGTCTGGAACTGTCTGGAACTGCTATCGCCTGAGGA

Full Affymetrix probeset data:

Annotations for 1628278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720