Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628279_s_at:

>probe:Drosophila_2:1628279_s_at:483:247; Interrogation_Position=1110; Antisense; AATTGCACTTTGTCAAGGCGTGTTC
>probe:Drosophila_2:1628279_s_at:597:249; Interrogation_Position=1123; Antisense; CAAGGCGTGTTCACAGCACTATGAA
>probe:Drosophila_2:1628279_s_at:425:459; Interrogation_Position=549; Antisense; GATTTCCACATCTCTTAGTCAAGCA
>probe:Drosophila_2:1628279_s_at:534:423; Interrogation_Position=577; Antisense; GAGAAATTCTTGGAAGCTACTGCCA
>probe:Drosophila_2:1628279_s_at:702:377; Interrogation_Position=589; Antisense; GAAGCTACTGCCAAGCTTCGCAGCA
>probe:Drosophila_2:1628279_s_at:50:353; Interrogation_Position=608; Antisense; GCAGCACTGCTAACTACTACAAGAT
>probe:Drosophila_2:1628279_s_at:361:279; Interrogation_Position=624; Antisense; CTACAAGATCCGGAGCAAGCTGCAC
>probe:Drosophila_2:1628279_s_at:231:129; Interrogation_Position=649; Antisense; ACCACCACACAGACGCTAGAACAAA
>probe:Drosophila_2:1628279_s_at:519:499; Interrogation_Position=685; Antisense; GTGCGACAGTCGGTGCTTACCGGTC
>probe:Drosophila_2:1628279_s_at:299:703; Interrogation_Position=701; Antisense; TTACCGGTCGTACGCCGCAGTTCAT
>probe:Drosophila_2:1628279_s_at:581:381; Interrogation_Position=795; Antisense; GAACCCAGCAGAGGAAGTTGGTCCT
>probe:Drosophila_2:1628279_s_at:414:467; Interrogation_Position=811; Antisense; GTTGGTCCTGCCAAAATGCGCAAGA
>probe:Drosophila_2:1628279_s_at:24:209; Interrogation_Position=910; Antisense; AAGCAACGGCCGCTAATGACCTGGA
>probe:Drosophila_2:1628279_s_at:125:57; Interrogation_Position=925; Antisense; ATGACCTGGACGAAGTAATTGCACA

Paste this into a BLAST search page for me
AATTGCACTTTGTCAAGGCGTGTTCCAAGGCGTGTTCACAGCACTATGAAGATTTCCACATCTCTTAGTCAAGCAGAGAAATTCTTGGAAGCTACTGCCAGAAGCTACTGCCAAGCTTCGCAGCAGCAGCACTGCTAACTACTACAAGATCTACAAGATCCGGAGCAAGCTGCACACCACCACACAGACGCTAGAACAAAGTGCGACAGTCGGTGCTTACCGGTCTTACCGGTCGTACGCCGCAGTTCATGAACCCAGCAGAGGAAGTTGGTCCTGTTGGTCCTGCCAAAATGCGCAAGAAAGCAACGGCCGCTAATGACCTGGAATGACCTGGACGAAGTAATTGCACA

Full Affymetrix probeset data:

Annotations for 1628279_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime