Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628281_at:

>probe:Drosophila_2:1628281_at:555:479; Interrogation_Position=1684; Antisense; GTTTCGAATTTAACATAGCCACATT
>probe:Drosophila_2:1628281_at:167:125; Interrogation_Position=1700; Antisense; AGCCACATTTAGACATTCTGGGCCT
>probe:Drosophila_2:1628281_at:338:151; Interrogation_Position=1712; Antisense; ACATTCTGGGCCTAGAGATCCGCTA
>probe:Drosophila_2:1628281_at:510:427; Interrogation_Position=1726; Antisense; GAGATCCGCTATCCTATTATACAGA
>probe:Drosophila_2:1628281_at:633:457; Interrogation_Position=1749; Antisense; GATATGTTTAACCATTCGTCGATCC
>probe:Drosophila_2:1628281_at:251:7; Interrogation_Position=1762; Antisense; ATTCGTCGATCCTCCGCGAAGTAAT
>probe:Drosophila_2:1628281_at:306:263; Interrogation_Position=1800; Antisense; CAGACCCTTTTTTTCGATATCCATT
>probe:Drosophila_2:1628281_at:252:723; Interrogation_Position=1858; Antisense; TTGAAACGAGATATCCCTTCACCGC
>probe:Drosophila_2:1628281_at:483:599; Interrogation_Position=1956; Antisense; TGTAATTCCACGCAAAATTCATGAA
>probe:Drosophila_2:1628281_at:464:455; Interrogation_Position=2027; Antisense; GATAATTGTCTGTGCATCCTTCGGC
>probe:Drosophila_2:1628281_at:363:307; Interrogation_Position=2044; Antisense; CCTTCGGCATGGACTCTACTATATA
>probe:Drosophila_2:1628281_at:207:557; Interrogation_Position=2054; Antisense; GGACTCTACTATATATACACTGATA
>probe:Drosophila_2:1628281_at:569:425; Interrogation_Position=2113; Antisense; GAGAGAAAGCATTCAACACACACAC
>probe:Drosophila_2:1628281_at:95:159; Interrogation_Position=2136; Antisense; ACACACTACACACATGCATACGTAC

Paste this into a BLAST search page for me
GTTTCGAATTTAACATAGCCACATTAGCCACATTTAGACATTCTGGGCCTACATTCTGGGCCTAGAGATCCGCTAGAGATCCGCTATCCTATTATACAGAGATATGTTTAACCATTCGTCGATCCATTCGTCGATCCTCCGCGAAGTAATCAGACCCTTTTTTTCGATATCCATTTTGAAACGAGATATCCCTTCACCGCTGTAATTCCACGCAAAATTCATGAAGATAATTGTCTGTGCATCCTTCGGCCCTTCGGCATGGACTCTACTATATAGGACTCTACTATATATACACTGATAGAGAGAAAGCATTCAACACACACACACACACTACACACATGCATACGTAC

Full Affymetrix probeset data:

Annotations for 1628281_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime