Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628282_at:

>probe:Drosophila_2:1628282_at:243:711; Interrogation_Position=2243; Antisense; TTAAGAGCGGCTACATCACTGATGA
>probe:Drosophila_2:1628282_at:674:623; Interrogation_Position=2274; Antisense; TGCCGATAAGACTGTGTTCCCCAAT
>probe:Drosophila_2:1628282_at:124:443; Interrogation_Position=2302; Antisense; GATGTCATCAAACTGCTCATCCAGT
>probe:Drosophila_2:1628282_at:178:49; Interrogation_Position=2320; Antisense; ATCCAGTGCGGCGTTGATGTCAACA
>probe:Drosophila_2:1628282_at:611:427; Interrogation_Position=2407; Antisense; GAGATTGTTCACCTTTTGCTCAAGT
>probe:Drosophila_2:1628282_at:597:549; Interrogation_Position=2434; Antisense; GGAGGTGACATCGATCAGCCGAATC
>probe:Drosophila_2:1628282_at:166:613; Interrogation_Position=2463; Antisense; TGACAAGCGGCCCTACGACTTAATA
>probe:Drosophila_2:1628282_at:676:129; Interrogation_Position=2506; Antisense; ACCATTCCACTGCTCAACTTTGTAA
>probe:Drosophila_2:1628282_at:364:491; Interrogation_Position=2527; Antisense; GTAACCCTGCAGTGTTTGGCGGCCA
>probe:Drosophila_2:1628282_at:239:573; Interrogation_Position=2553; Antisense; GGCGATAAGCAAACACCGGATACCC
>probe:Drosophila_2:1628282_at:609:615; Interrogation_Position=2591; Antisense; TGCACAGGCAGCTCGAGAAGTTCGT
>probe:Drosophila_2:1628282_at:385:573; Interrogation_Position=2711; Antisense; GGCGTTTCAACCTAGGATGCTTACC
>probe:Drosophila_2:1628282_at:470:547; Interrogation_Position=2725; Antisense; GGATGCTTACCTCCTTATGGAATTT
>probe:Drosophila_2:1628282_at:474:485; Interrogation_Position=2766; Antisense; GTCGGTAACTTTGTTTCGCTCTATA

Paste this into a BLAST search page for me
TTAAGAGCGGCTACATCACTGATGATGCCGATAAGACTGTGTTCCCCAATGATGTCATCAAACTGCTCATCCAGTATCCAGTGCGGCGTTGATGTCAACAGAGATTGTTCACCTTTTGCTCAAGTGGAGGTGACATCGATCAGCCGAATCTGACAAGCGGCCCTACGACTTAATAACCATTCCACTGCTCAACTTTGTAAGTAACCCTGCAGTGTTTGGCGGCCAGGCGATAAGCAAACACCGGATACCCTGCACAGGCAGCTCGAGAAGTTCGTGGCGTTTCAACCTAGGATGCTTACCGGATGCTTACCTCCTTATGGAATTTGTCGGTAACTTTGTTTCGCTCTATA

Full Affymetrix probeset data:

Annotations for 1628282_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime