FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628283_at:

>probe:Drosophila_2:1628283_at:392:609; Interrogation_Position=1530; Antisense; TGAGCCAACGATTTACCACACGCGA
>probe:Drosophila_2:1628283_at:500:227; Interrogation_Position=1554; Antisense; AAGGCGTTGCCACTCGAGTGCTGAA
>probe:Drosophila_2:1628283_at:206:87; Interrogation_Position=1570; Antisense; AGTGCTGAACCTTCTCTGCGAGATT
>probe:Drosophila_2:1628283_at:383:729; Interrogation_Position=1593; Antisense; TTGTGGAGCGTTCCGATTTGTACAC
>probe:Drosophila_2:1628283_at:473:17; Interrogation_Position=1608; Antisense; ATTTGTACACGCACTTTGGCGGCGA
>probe:Drosophila_2:1628283_at:209:189; Interrogation_Position=1632; Antisense; AACAGAGATTCACTCCGTTTCTCAG
>probe:Drosophila_2:1628283_at:200:99; Interrogation_Position=1695; Antisense; AGAGTACATTGCGAGCCATGGCCAC
>probe:Drosophila_2:1628283_at:371:641; Interrogation_Position=1722; Antisense; TCTGCCGCCAACTGAATGGAGTCTT
>probe:Drosophila_2:1628283_at:244:229; Interrogation_Position=1736; Antisense; AATGGAGTCTTCATGGCCGCTCTAG
>probe:Drosophila_2:1628283_at:248:677; Interrogation_Position=1758; Antisense; TAGTCCGTTCTGCTCCTGAGATAGT
>probe:Drosophila_2:1628283_at:159:657; Interrogation_Position=1795; Antisense; TAAGCTGCAGATCACGGGCGATATC
>probe:Drosophila_2:1628283_at:234:207; Interrogation_Position=1847; Antisense; AAGCGTGTTCTTAACTTGTTCTACT
>probe:Drosophila_2:1628283_at:47:573; Interrogation_Position=1966; Antisense; GGCTGTACTCGGCTACAACTAGTGA
>probe:Drosophila_2:1628283_at:460:407; Interrogation_Position=1996; Antisense; GACGGGAATCCGCAATATACACAGT

Paste this into a BLAST search page for me
TGAGCCAACGATTTACCACACGCGAAAGGCGTTGCCACTCGAGTGCTGAAAGTGCTGAACCTTCTCTGCGAGATTTTGTGGAGCGTTCCGATTTGTACACATTTGTACACGCACTTTGGCGGCGAAACAGAGATTCACTCCGTTTCTCAGAGAGTACATTGCGAGCCATGGCCACTCTGCCGCCAACTGAATGGAGTCTTAATGGAGTCTTCATGGCCGCTCTAGTAGTCCGTTCTGCTCCTGAGATAGTTAAGCTGCAGATCACGGGCGATATCAAGCGTGTTCTTAACTTGTTCTACTGGCTGTACTCGGCTACAACTAGTGAGACGGGAATCCGCAATATACACAGT

Full Affymetrix probeset data:

Annotations for 1628283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720