FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628284_at:

>probe:Drosophila_2:1628284_at:431:161; Interrogation_Position=1225; Antisense; ACAATCTGATTGTGGCCGGTGCTGG
>probe:Drosophila_2:1628284_at:187:509; Interrogation_Position=1243; Antisense; GTGCTGGCTTTGTGGCATACATGCT
>probe:Drosophila_2:1628284_at:527:29; Interrogation_Position=1259; Antisense; ATACATGCTGGCTGGGTTCCTGGTA
>probe:Drosophila_2:1628284_at:487:701; Interrogation_Position=1275; Antisense; TTCCTGGTAAACTTGGTTGGCGTCA
>probe:Drosophila_2:1628284_at:60:233; Interrogation_Position=1307; Antisense; AATGACCAGTGGACTCCTCATAGCG
>probe:Drosophila_2:1628284_at:279:27; Interrogation_Position=1326; Antisense; ATAGCGGCCGGCTGTTCCATTGGGA
>probe:Drosophila_2:1628284_at:485:273; Interrogation_Position=1343; Antisense; CATTGGGATGTACTGGTCCAGCTCA
>probe:Drosophila_2:1628284_at:50:151; Interrogation_Position=1385; Antisense; ACTTGCTTCGCTTTTTGTGACCATG
>probe:Drosophila_2:1628284_at:301:23; Interrogation_Position=1416; Antisense; ATATCGGCCACATCAGTGATCAGCG
>probe:Drosophila_2:1628284_at:138:255; Interrogation_Position=1526; Antisense; CAACATTTTCTTCCCGGCTTTGATG
>probe:Drosophila_2:1628284_at:597:605; Interrogation_Position=1579; Antisense; TGATCAGTGCATTCATGCTGGCCGG
>probe:Drosophila_2:1628284_at:355:85; Interrogation_Position=1651; Antisense; AGTGAGCTCCTTTGGACTGAACCGC
>probe:Drosophila_2:1628284_at:222:79; Interrogation_Position=1679; Antisense; AGGATTCCAGTTTGGTTCCATTCCA
>probe:Drosophila_2:1628284_at:259:329; Interrogation_Position=1755; Antisense; GCGGAAAAAGCGTCCTTCGCCAGAA

Paste this into a BLAST search page for me
ACAATCTGATTGTGGCCGGTGCTGGGTGCTGGCTTTGTGGCATACATGCTATACATGCTGGCTGGGTTCCTGGTATTCCTGGTAAACTTGGTTGGCGTCAAATGACCAGTGGACTCCTCATAGCGATAGCGGCCGGCTGTTCCATTGGGACATTGGGATGTACTGGTCCAGCTCAACTTGCTTCGCTTTTTGTGACCATGATATCGGCCACATCAGTGATCAGCGCAACATTTTCTTCCCGGCTTTGATGTGATCAGTGCATTCATGCTGGCCGGAGTGAGCTCCTTTGGACTGAACCGCAGGATTCCAGTTTGGTTCCATTCCAGCGGAAAAAGCGTCCTTCGCCAGAA

Full Affymetrix probeset data:

Annotations for 1628284_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720