Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628289_at:

>probe:Drosophila_2:1628289_at:443:473; Interrogation_Position=1889; Antisense; GTTATCGAGGGTTCCCAGTCGAATC
>probe:Drosophila_2:1628289_at:94:719; Interrogation_Position=1900; Antisense; TTCCCAGTCGAATCTCGGCGAGAGT
>probe:Drosophila_2:1628289_at:98:689; Interrogation_Position=1949; Antisense; TATTCTTAGAGCGATCCCAAGGCGT
>probe:Drosophila_2:1628289_at:651:445; Interrogation_Position=1961; Antisense; GATCCCAAGGCGTTAGGCTAAGTGT
>probe:Drosophila_2:1628289_at:603:481; Interrogation_Position=2000; Antisense; GTATTAGAGACCCTTTCTCTCCATC
>probe:Drosophila_2:1628289_at:583:713; Interrogation_Position=2030; Antisense; TTCTCTCTCAAGATCCGTGCCAAAT
>probe:Drosophila_2:1628289_at:657:505; Interrogation_Position=2046; Antisense; GTGCCAAATCCTTGCGAAGTTTCGA
>probe:Drosophila_2:1628289_at:390:601; Interrogation_Position=2099; Antisense; TGTTTCCTTTCTTTCCCAAATATCA
>probe:Drosophila_2:1628289_at:122:341; Interrogation_Position=2160; Antisense; GCTAGACACCACCAACTATAACTGT
>probe:Drosophila_2:1628289_at:306:41; Interrogation_Position=2254; Antisense; ATCGTACTCGATCCACTAGCTATTG
>probe:Drosophila_2:1628289_at:208:709; Interrogation_Position=2329; Antisense; TTAAGCACGAACCTCTAGAGTCCCT
>probe:Drosophila_2:1628289_at:662:677; Interrogation_Position=2344; Antisense; TAGAGTCCCTCAACTGCAGCTGGAT
>probe:Drosophila_2:1628289_at:581:121; Interrogation_Position=2378; Antisense; AGCCGTCTAATATAAAGCCCTAGTT
>probe:Drosophila_2:1628289_at:611:465; Interrogation_Position=2400; Antisense; GTTGCTAGTAACTACATCCTAAGCT

Paste this into a BLAST search page for me
GTTATCGAGGGTTCCCAGTCGAATCTTCCCAGTCGAATCTCGGCGAGAGTTATTCTTAGAGCGATCCCAAGGCGTGATCCCAAGGCGTTAGGCTAAGTGTGTATTAGAGACCCTTTCTCTCCATCTTCTCTCTCAAGATCCGTGCCAAATGTGCCAAATCCTTGCGAAGTTTCGATGTTTCCTTTCTTTCCCAAATATCAGCTAGACACCACCAACTATAACTGTATCGTACTCGATCCACTAGCTATTGTTAAGCACGAACCTCTAGAGTCCCTTAGAGTCCCTCAACTGCAGCTGGATAGCCGTCTAATATAAAGCCCTAGTTGTTGCTAGTAACTACATCCTAAGCT

Full Affymetrix probeset data:

Annotations for 1628289_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime