FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628291_at:

>probe:Drosophila_2:1628291_at:401:389; Interrogation_Position=1031; Antisense; GAAAACACGCATTGTTATTCCCCGG
>probe:Drosophila_2:1628291_at:372:549; Interrogation_Position=1088; Antisense; GGAGGATGCCTATTACGATGACGAT
>probe:Drosophila_2:1628291_at:730:619; Interrogation_Position=1120; Antisense; TGCTCTACCGAGTGCCTGGAATGAC
>probe:Drosophila_2:1628291_at:97:223; Interrogation_Position=570; Antisense; AAGGGTGACTTCAGTATCCCACCGT
>probe:Drosophila_2:1628291_at:718:345; Interrogation_Position=605; Antisense; GCATCTGCAGAAATTCGCCGAGCGA
>probe:Drosophila_2:1628291_at:272:673; Interrogation_Position=685; Antisense; TACCGACTCCGCAAGGCAACGAATT
>probe:Drosophila_2:1628291_at:623:363; Interrogation_Position=705; Antisense; GAATTCCGCAAACTGCTGGGCAGCA
>probe:Drosophila_2:1628291_at:47:101; Interrogation_Position=743; Antisense; AGAGGAGATGCCTACACCACAAATC
>probe:Drosophila_2:1628291_at:40:285; Interrogation_Position=793; Antisense; CTGCTGCCGAAGATGAAACCTATTT
>probe:Drosophila_2:1628291_at:556:247; Interrogation_Position=868; Antisense; AATTGCAGCTCGTTGAGTCTGCGCC
>probe:Drosophila_2:1628291_at:406:625; Interrogation_Position=887; Antisense; TGCGCCCGCAGTTCCAGAGGAAATG
>probe:Drosophila_2:1628291_at:728:229; Interrogation_Position=908; Antisense; AATGAAGCGGCCCATCGAGAATCCC
>probe:Drosophila_2:1628291_at:641:91; Interrogation_Position=954; Antisense; AGTTTCGTGCCCAAGTTTGCGAGCA
>probe:Drosophila_2:1628291_at:97:429; Interrogation_Position=981; Antisense; GAGATTGTGATCAGTGCCGCGGATC

Paste this into a BLAST search page for me
GAAAACACGCATTGTTATTCCCCGGGGAGGATGCCTATTACGATGACGATTGCTCTACCGAGTGCCTGGAATGACAAGGGTGACTTCAGTATCCCACCGTGCATCTGCAGAAATTCGCCGAGCGATACCGACTCCGCAAGGCAACGAATTGAATTCCGCAAACTGCTGGGCAGCAAGAGGAGATGCCTACACCACAAATCCTGCTGCCGAAGATGAAACCTATTTAATTGCAGCTCGTTGAGTCTGCGCCTGCGCCCGCAGTTCCAGAGGAAATGAATGAAGCGGCCCATCGAGAATCCCAGTTTCGTGCCCAAGTTTGCGAGCAGAGATTGTGATCAGTGCCGCGGATC

Full Affymetrix probeset data:

Annotations for 1628291_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720