Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628293_a_at:

>probe:Drosophila_2:1628293_a_at:694:431; Interrogation_Position=1025; Antisense; GAGTCCCACGAGAGTCTGCTGCAGA
>probe:Drosophila_2:1628293_a_at:430:641; Interrogation_Position=1039; Antisense; TCTGCTGCAGACGATGCGGGAGCTC
>probe:Drosophila_2:1628293_a_at:192:125; Interrogation_Position=1066; Antisense; AGCCCTGGGAGTCCTAAGCAACAGC
>probe:Drosophila_2:1628293_a_at:246:197; Interrogation_Position=1094; Antisense; AACGGCACCCACAAGAAGGCGGCCA
>probe:Drosophila_2:1628293_a_at:714:63; Interrogation_Position=1178; Antisense; ATGGATGGCGGCAGGATCGTCTACC
>probe:Drosophila_2:1628293_a_at:520:391; Interrogation_Position=774; Antisense; GAAAGCGACTCAGCTTGGCCGAGGA
>probe:Drosophila_2:1628293_a_at:356:437; Interrogation_Position=794; Antisense; GAGGAGCTGATCACCGATCCCATAT
>probe:Drosophila_2:1628293_a_at:577:45; Interrogation_Position=810; Antisense; ATCCCATATTCCTGTTCTGCGATGA
>probe:Drosophila_2:1628293_a_at:77:277; Interrogation_Position=856; Antisense; CTTCAGCGCCTATTCGGTGATCAAA
>probe:Drosophila_2:1628293_a_at:327:533; Interrogation_Position=871; Antisense; GGTGATCAAAACACTCAGGCACTTG
>probe:Drosophila_2:1628293_a_at:254:73; Interrogation_Position=887; Antisense; AGGCACTTGTGCACCAGGCGACGGA
>probe:Drosophila_2:1628293_a_at:655:407; Interrogation_Position=906; Antisense; GACGGATTGCCAAACATTCCTTGAA
>probe:Drosophila_2:1628293_a_at:569:1; Interrogation_Position=921; Antisense; ATTCCTTGAACCAGGTCTACGGCGA
>probe:Drosophila_2:1628293_a_at:471:669; Interrogation_Position=938; Antisense; TACGGCGAGGACTCGTTTGAGACGC

Paste this into a BLAST search page for me
GAGTCCCACGAGAGTCTGCTGCAGATCTGCTGCAGACGATGCGGGAGCTCAGCCCTGGGAGTCCTAAGCAACAGCAACGGCACCCACAAGAAGGCGGCCAATGGATGGCGGCAGGATCGTCTACCGAAAGCGACTCAGCTTGGCCGAGGAGAGGAGCTGATCACCGATCCCATATATCCCATATTCCTGTTCTGCGATGACTTCAGCGCCTATTCGGTGATCAAAGGTGATCAAAACACTCAGGCACTTGAGGCACTTGTGCACCAGGCGACGGAGACGGATTGCCAAACATTCCTTGAAATTCCTTGAACCAGGTCTACGGCGATACGGCGAGGACTCGTTTGAGACGC

Full Affymetrix probeset data:

Annotations for 1628293_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime