FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628295_at:

>probe:Drosophila_2:1628295_at:532:601; Interrogation_Position=137; Antisense; TGTTCTCGAGATTAGCCTTACGTCC
>probe:Drosophila_2:1628295_at:348:707; Interrogation_Position=154; Antisense; TTACGTCCTTTGACTGTGGCCACAT
>probe:Drosophila_2:1628295_at:47:225; Interrogation_Position=206; Antisense; AAGGACTAAGTAGGCTCCCTGGGCA
>probe:Drosophila_2:1628295_at:686:633; Interrogation_Position=221; Antisense; TCCCTGGGCATGGAAGTCCCGGAAA
>probe:Drosophila_2:1628295_at:203:579; Interrogation_Position=298; Antisense; GGCCTGTTGGCATATATCTGTTCCG
>probe:Drosophila_2:1628295_at:436:345; Interrogation_Position=317; Antisense; GTTCCGGAGACTGTTGCGCCATTAA
>probe:Drosophila_2:1628295_at:344:11; Interrogation_Position=337; Antisense; ATTAAGCACGAGCACAGCGGCCTAT
>probe:Drosophila_2:1628295_at:305:67; Interrogation_Position=380; Antisense; ATGGCTACTACAGCAGTGGAATCAC
>probe:Drosophila_2:1628295_at:30:519; Interrogation_Position=395; Antisense; GTGGAATCACCATCGGTATCCTGAC
>probe:Drosophila_2:1628295_at:598:537; Interrogation_Position=409; Antisense; GGTATCCTGACCACATTTGCTGTGA
>probe:Drosophila_2:1628295_at:307:19; Interrogation_Position=423; Antisense; ATTTGCTGTGATTAGGCTTCTTCCA
>probe:Drosophila_2:1628295_at:338:677; Interrogation_Position=435; Antisense; TAGGCTTCTTCCAGCGATTGTAAAG
>probe:Drosophila_2:1628295_at:202:97; Interrogation_Position=518; Antisense; AGATCAAGGTCCTATCAATCTCGCC
>probe:Drosophila_2:1628295_at:55:237; Interrogation_Position=534; Antisense; AATCTCGCCCTCGAACGGAAATAAG

Paste this into a BLAST search page for me
TGTTCTCGAGATTAGCCTTACGTCCTTACGTCCTTTGACTGTGGCCACATAAGGACTAAGTAGGCTCCCTGGGCATCCCTGGGCATGGAAGTCCCGGAAAGGCCTGTTGGCATATATCTGTTCCGGTTCCGGAGACTGTTGCGCCATTAAATTAAGCACGAGCACAGCGGCCTATATGGCTACTACAGCAGTGGAATCACGTGGAATCACCATCGGTATCCTGACGGTATCCTGACCACATTTGCTGTGAATTTGCTGTGATTAGGCTTCTTCCATAGGCTTCTTCCAGCGATTGTAAAGAGATCAAGGTCCTATCAATCTCGCCAATCTCGCCCTCGAACGGAAATAAG

Full Affymetrix probeset data:

Annotations for 1628295_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720