Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628296_at:

>probe:Drosophila_2:1628296_at:554:185; Interrogation_Position=1866; Antisense; AACAACAAGCGCTGCCTGGAGGGAT
>probe:Drosophila_2:1628296_at:10:519; Interrogation_Position=1914; Antisense; GTGGTGGCCAATTCCTGCGAGAATG
>probe:Drosophila_2:1628296_at:567:461; Interrogation_Position=1966; Antisense; GATTCGTGAACCACACTATGCTGGA
>probe:Drosophila_2:1628296_at:376:557; Interrogation_Position=1988; Antisense; GGACACCTTCTACGATGGATTAAAG
>probe:Drosophila_2:1628296_at:634:171; Interrogation_Position=2009; Antisense; AAAGTAGACTTTCATCCACGAGCCA
>probe:Drosophila_2:1628296_at:642:185; Interrogation_Position=2036; Antisense; AACAATTCGAGTAACCACAGGCCAG
>probe:Drosophila_2:1628296_at:239:153; Interrogation_Position=2052; Antisense; ACAGGCCAGATGTCGATCGGTTCAG
>probe:Drosophila_2:1628296_at:199:447; Interrogation_Position=2089; Antisense; GATCGTCACGGGTTTAGTTCATTGT
>probe:Drosophila_2:1628296_at:621:271; Interrogation_Position=2158; Antisense; CATTTTTCCATTAATTCTTGCCCCA
>probe:Drosophila_2:1628296_at:220:587; Interrogation_Position=2220; Antisense; TGGACAGGCAGATCGCAATCGGAGC
>probe:Drosophila_2:1628296_at:493:417; Interrogation_Position=2241; Antisense; GAGCGAGGATTCTGTCCGATCGCGA
>probe:Drosophila_2:1628296_at:15:327; Interrogation_Position=2262; Antisense; GCGAGCCACAAACTCTGATCTTTAT
>probe:Drosophila_2:1628296_at:62:451; Interrogation_Position=2278; Antisense; GATCTTTATTTGCTGTACGTACACT
>probe:Drosophila_2:1628296_at:488:375; Interrogation_Position=2324; Antisense; GAAGAGATCCTCGACTACTTGTAAA

Paste this into a BLAST search page for me
AACAACAAGCGCTGCCTGGAGGGATGTGGTGGCCAATTCCTGCGAGAATGGATTCGTGAACCACACTATGCTGGAGGACACCTTCTACGATGGATTAAAGAAAGTAGACTTTCATCCACGAGCCAAACAATTCGAGTAACCACAGGCCAGACAGGCCAGATGTCGATCGGTTCAGGATCGTCACGGGTTTAGTTCATTGTCATTTTTCCATTAATTCTTGCCCCATGGACAGGCAGATCGCAATCGGAGCGAGCGAGGATTCTGTCCGATCGCGAGCGAGCCACAAACTCTGATCTTTATGATCTTTATTTGCTGTACGTACACTGAAGAGATCCTCGACTACTTGTAAA

Full Affymetrix probeset data:

Annotations for 1628296_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime