FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628299_at:

>probe:Drosophila_2:1628299_at:573:275; Interrogation_Position=1014; Antisense; CTAGATCAAAGCTTCCACATCCTAA
>probe:Drosophila_2:1628299_at:58:685; Interrogation_Position=1057; Antisense; TATTGTAACCGTTTTCCTCGTAGAG
>probe:Drosophila_2:1628299_at:102:631; Interrogation_Position=1071; Antisense; TCCTCGTAGAGTTAAGTGGCTGCAT
>probe:Drosophila_2:1628299_at:627:323; Interrogation_Position=1212; Antisense; GCGACATTCAAAGCCGCGTTCGAAA
>probe:Drosophila_2:1628299_at:449:407; Interrogation_Position=646; Antisense; GACGGTCTGCAGAACCTGGAATTGA
>probe:Drosophila_2:1628299_at:67:463; Interrogation_Position=669; Antisense; GATTCTGTGCCTCAACGTATTGGAC
>probe:Drosophila_2:1628299_at:147:587; Interrogation_Position=689; Antisense; TGGACCGCTGCTTCGATTCATTCAA
>probe:Drosophila_2:1628299_at:714:437; Interrogation_Position=721; Antisense; GAGGACATTCACCTGGCACTAGCTC
>probe:Drosophila_2:1628299_at:338:425; Interrogation_Position=751; Antisense; GGTCGAGCAGTTGTGGCCTTAGTAC
>probe:Drosophila_2:1628299_at:198:149; Interrogation_Position=774; Antisense; ACTTCCCTACATGCACTACGTGGAG
>probe:Drosophila_2:1628299_at:304:519; Interrogation_Position=793; Antisense; GTGGAGACGAATACCTCGCATCTGC
>probe:Drosophila_2:1628299_at:709:337; Interrogation_Position=905; Antisense; GCTACCGCGTGGAGGCATGGACCAA
>probe:Drosophila_2:1628299_at:618:489; Interrogation_Position=936; Antisense; GTACTTGTGCGAGGGTGATCTCCAC
>probe:Drosophila_2:1628299_at:2:607; Interrogation_Position=951; Antisense; TGATCTCCACCAGTCGTTCTATTGG

Paste this into a BLAST search page for me
CTAGATCAAAGCTTCCACATCCTAATATTGTAACCGTTTTCCTCGTAGAGTCCTCGTAGAGTTAAGTGGCTGCATGCGACATTCAAAGCCGCGTTCGAAAGACGGTCTGCAGAACCTGGAATTGAGATTCTGTGCCTCAACGTATTGGACTGGACCGCTGCTTCGATTCATTCAAGAGGACATTCACCTGGCACTAGCTCGGTCGAGCAGTTGTGGCCTTAGTACACTTCCCTACATGCACTACGTGGAGGTGGAGACGAATACCTCGCATCTGCGCTACCGCGTGGAGGCATGGACCAAGTACTTGTGCGAGGGTGATCTCCACTGATCTCCACCAGTCGTTCTATTGG

Full Affymetrix probeset data:

Annotations for 1628299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720