Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628300_s_at:

>probe:Drosophila_2:1628300_s_at:251:127; Interrogation_Position=118; Antisense; AGCCAGATATCCTCTAGATGCAGAT
>probe:Drosophila_2:1628300_s_at:80:691; Interrogation_Position=150; Antisense; TTTGGTGTATCTCCTAGTTGTGGTA
>probe:Drosophila_2:1628300_s_at:22:727; Interrogation_Position=167; Antisense; TTGTGGTAATACTTCTGCTGGCCTT
>probe:Drosophila_2:1628300_s_at:699:283; Interrogation_Position=181; Antisense; CTGCTGGCCTTGGTTCAATGGGAAC
>probe:Drosophila_2:1628300_s_at:240:251; Interrogation_Position=196; Antisense; CAATGGGAACTTGTGTGCTACTACA
>probe:Drosophila_2:1628300_s_at:33:663; Interrogation_Position=227; Antisense; TAACAGATCTTTTCTTGGCCCAGTA
>probe:Drosophila_2:1628300_s_at:655:679; Interrogation_Position=258; Antisense; TAGTGTATCCTGCATGCTGATCTCA
>probe:Drosophila_2:1628300_s_at:625:691; Interrogation_Position=291; Antisense; TTTGGCCATATTCCTTCTCATTCGA
>probe:Drosophila_2:1628300_s_at:608:673; Interrogation_Position=329; Antisense; TACCAATTCTGGGATGCCTGCTAAT
>probe:Drosophila_2:1628300_s_at:113:51; Interrogation_Position=342; Antisense; ATGCCTGCTAATGTGCTCCATTGTA
>probe:Drosophila_2:1628300_s_at:597:695; Interrogation_Position=462; Antisense; TTTCTGTCACTTCTGCATTATCTTG
>probe:Drosophila_2:1628300_s_at:655:701; Interrogation_Position=491; Antisense; TTTTCTGCTTTTTGGACTGGTCACA
>probe:Drosophila_2:1628300_s_at:94:499; Interrogation_Position=577; Antisense; GTCTCCACAGCTGCCATTGAAGATG
>probe:Drosophila_2:1628300_s_at:193:691; Interrogation_Position=606; Antisense; TTTGGGTCAGACCACTCAGGACTTC

Paste this into a BLAST search page for me
AGCCAGATATCCTCTAGATGCAGATTTTGGTGTATCTCCTAGTTGTGGTATTGTGGTAATACTTCTGCTGGCCTTCTGCTGGCCTTGGTTCAATGGGAACCAATGGGAACTTGTGTGCTACTACATAACAGATCTTTTCTTGGCCCAGTATAGTGTATCCTGCATGCTGATCTCATTTGGCCATATTCCTTCTCATTCGATACCAATTCTGGGATGCCTGCTAATATGCCTGCTAATGTGCTCCATTGTATTTCTGTCACTTCTGCATTATCTTGTTTTCTGCTTTTTGGACTGGTCACAGTCTCCACAGCTGCCATTGAAGATGTTTGGGTCAGACCACTCAGGACTTC

Full Affymetrix probeset data:

Annotations for 1628300_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime