Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628302_at:

>probe:Drosophila_2:1628302_at:13:409; Interrogation_Position=112; Antisense; GACGTGAGCGACTTCTTTGACGCCA
>probe:Drosophila_2:1628302_at:459:39; Interrogation_Position=136; Antisense; ATCTCGCTGGACGATGTGGCCAATA
>probe:Drosophila_2:1628302_at:704:623; Interrogation_Position=14; Antisense; TGCGCGGACAACTGAAAGAGTACGT
>probe:Drosophila_2:1628302_at:20:443; Interrogation_Position=148; Antisense; GATGTGGCCAATACCGGGCGCAACA
>probe:Drosophila_2:1628302_at:232:577; Interrogation_Position=164; Antisense; GGCGCAACACCCATCCGGAGCAGTT
>probe:Drosophila_2:1628302_at:640:419; Interrogation_Position=181; Antisense; GAGCAGTTCTGCCTCATGCCGGCAC
>probe:Drosophila_2:1628302_at:182:467; Interrogation_Position=236; Antisense; GTTGGCGCTACGATCCGGAGCAGAA
>probe:Drosophila_2:1628302_at:163:207; Interrogation_Position=259; Antisense; AAGAAGTGCGTGGAGTTCAAGTTCG
>probe:Drosophila_2:1628302_at:592:573; Interrogation_Position=286; Antisense; GGCTGTGACGGCAACGAGAACAACT
>probe:Drosophila_2:1628302_at:457:197; Interrogation_Position=298; Antisense; AACGAGAACAACTTCGCCAGCTACA
>probe:Drosophila_2:1628302_at:7:719; Interrogation_Position=310; Antisense; TTCGCCAGCTACAAGGACTGCATGT
>probe:Drosophila_2:1628302_at:705:405; Interrogation_Position=325; Antisense; GACTGCATGTCCACCTGCGAGGGCA
>probe:Drosophila_2:1628302_at:728:65; Interrogation_Position=78; Antisense; ATGGAGCGAGGCGTTTCCCATGGAC
>probe:Drosophila_2:1628302_at:170:67; Interrogation_Position=97; Antisense; ATGGACCTCTACGACGACGTGAGCG

Paste this into a BLAST search page for me
GACGTGAGCGACTTCTTTGACGCCAATCTCGCTGGACGATGTGGCCAATATGCGCGGACAACTGAAAGAGTACGTGATGTGGCCAATACCGGGCGCAACAGGCGCAACACCCATCCGGAGCAGTTGAGCAGTTCTGCCTCATGCCGGCACGTTGGCGCTACGATCCGGAGCAGAAAAGAAGTGCGTGGAGTTCAAGTTCGGGCTGTGACGGCAACGAGAACAACTAACGAGAACAACTTCGCCAGCTACATTCGCCAGCTACAAGGACTGCATGTGACTGCATGTCCACCTGCGAGGGCAATGGAGCGAGGCGTTTCCCATGGACATGGACCTCTACGACGACGTGAGCG

Full Affymetrix probeset data:

Annotations for 1628302_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime