FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628306_at:

>probe:Drosophila_2:1628306_at:33:419; Interrogation_Position=1720; Antisense; GAGCATTCTCCACGCTAAACGAAAT
>probe:Drosophila_2:1628306_at:682:369; Interrogation_Position=1762; Antisense; GAATGTCTTACCTACATGTGTATTT
>probe:Drosophila_2:1628306_at:703:667; Interrogation_Position=1790; Antisense; TACTAGCTAACATTTGTGATTCCAA
>probe:Drosophila_2:1628306_at:451:179; Interrogation_Position=1861; Antisense; AAAAAGTCTTAGAGCGTCGCCCGCG
>probe:Drosophila_2:1628306_at:61:299; Interrogation_Position=1884; Antisense; CGCCTCGGGCTAGGTTAAACGCTAT
>probe:Drosophila_2:1628306_at:318:29; Interrogation_Position=1907; Antisense; ATACTAATCCTCAAATGTCCTTCCA
>probe:Drosophila_2:1628306_at:423:61; Interrogation_Position=1921; Antisense; ATGTCCTTCCATTGGCTTTGTTCAA
>probe:Drosophila_2:1628306_at:146:705; Interrogation_Position=1941; Antisense; TTCAATCCCTAATCCCGATCTTAAT
>probe:Drosophila_2:1628306_at:717:513; Interrogation_Position=1978; Antisense; GTGTTTGTAAACCAGTTCCCCATAT
>probe:Drosophila_2:1628306_at:147:469; Interrogation_Position=1992; Antisense; GTTCCCCATATTAGGGACCCATTCG
>probe:Drosophila_2:1628306_at:393:555; Interrogation_Position=2006; Antisense; GGACCCATTCGGCAATTCTTTATAT
>probe:Drosophila_2:1628306_at:656:5; Interrogation_Position=2039; Antisense; ATTGTTTACTTATTGGGCAGCAGCG
>probe:Drosophila_2:1628306_at:141:569; Interrogation_Position=2054; Antisense; GGCAGCAGCGAAATACCCATAAATT
>probe:Drosophila_2:1628306_at:13:499; Interrogation_Position=2164; Antisense; GTCTTAATACATAGTGAACCCCACA

Paste this into a BLAST search page for me
GAGCATTCTCCACGCTAAACGAAATGAATGTCTTACCTACATGTGTATTTTACTAGCTAACATTTGTGATTCCAAAAAAAGTCTTAGAGCGTCGCCCGCGCGCCTCGGGCTAGGTTAAACGCTATATACTAATCCTCAAATGTCCTTCCAATGTCCTTCCATTGGCTTTGTTCAATTCAATCCCTAATCCCGATCTTAATGTGTTTGTAAACCAGTTCCCCATATGTTCCCCATATTAGGGACCCATTCGGGACCCATTCGGCAATTCTTTATATATTGTTTACTTATTGGGCAGCAGCGGGCAGCAGCGAAATACCCATAAATTGTCTTAATACATAGTGAACCCCACA

Full Affymetrix probeset data:

Annotations for 1628306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720