FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628307_at:

>probe:Drosophila_2:1628307_at:265:175; Interrogation_Position=432; Antisense; AAACCATGTCCCGACTTTTGCTGCA
>probe:Drosophila_2:1628307_at:111:619; Interrogation_Position=453; Antisense; TGCAGTGCCGCAGAACTTTGCTGAT
>probe:Drosophila_2:1628307_at:481:605; Interrogation_Position=474; Antisense; TGATCCTTCGCCATCAAACGGCGGT
>probe:Drosophila_2:1628307_at:647:143; Interrogation_Position=526; Antisense; ACTGCTGGGAAAGTGCCAGTCCTTT
>probe:Drosophila_2:1628307_at:544:53; Interrogation_Position=558; Antisense; ATGAAAAGGATCTTGGCCAGCAGGA
>probe:Drosophila_2:1628307_at:685:559; Interrogation_Position=611; Antisense; GGAAATTCAAATGTCTGCAGCTAAA
>probe:Drosophila_2:1628307_at:429:671; Interrogation_Position=641; Antisense; TACCCCGTTCCCATTGAAGATCATA
>probe:Drosophila_2:1628307_at:725:703; Interrogation_Position=680; Antisense; TTACCATATTGTTGCCGGAGATCCC
>probe:Drosophila_2:1628307_at:484:425; Interrogation_Position=697; Antisense; GAGATCCCAGATGAATCGGGTCCAT
>probe:Drosophila_2:1628307_at:320:227; Interrogation_Position=710; Antisense; AATCGGGTCCATTTTACGGGCAGCT
>probe:Drosophila_2:1628307_at:208:183; Interrogation_Position=738; Antisense; AAAACGGATCGTGCACAGACATTAT
>probe:Drosophila_2:1628307_at:347:267; Interrogation_Position=814; Antisense; CAGGCGATGGCCAGACTTAGACAAG
>probe:Drosophila_2:1628307_at:155:83; Interrogation_Position=837; Antisense; AGTGATACAACATCCATTTCCCTGG
>probe:Drosophila_2:1628307_at:210:633; Interrogation_Position=855; Antisense; TCCCTGGTCGGTTTACGATGTCTGA

Paste this into a BLAST search page for me
AAACCATGTCCCGACTTTTGCTGCATGCAGTGCCGCAGAACTTTGCTGATTGATCCTTCGCCATCAAACGGCGGTACTGCTGGGAAAGTGCCAGTCCTTTATGAAAAGGATCTTGGCCAGCAGGAGGAAATTCAAATGTCTGCAGCTAAATACCCCGTTCCCATTGAAGATCATATTACCATATTGTTGCCGGAGATCCCGAGATCCCAGATGAATCGGGTCCATAATCGGGTCCATTTTACGGGCAGCTAAAACGGATCGTGCACAGACATTATCAGGCGATGGCCAGACTTAGACAAGAGTGATACAACATCCATTTCCCTGGTCCCTGGTCGGTTTACGATGTCTGA

Full Affymetrix probeset data:

Annotations for 1628307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720