Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628309_at:

>probe:Drosophila_2:1628309_at:558:97; Interrogation_Position=1112; Antisense; AGATCTACGCCGACTTGTTGCGCAA
>probe:Drosophila_2:1628309_at:402:469; Interrogation_Position=1128; Antisense; GTTGCGCAAGTACCATCGAAGCATG
>probe:Drosophila_2:1628309_at:409:59; Interrogation_Position=1159; Antisense; ATGTTGGAACTGGTTCTGCGCCGAA
>probe:Drosophila_2:1628309_at:314:137; Interrogation_Position=1202; Antisense; ACGATCGGGTGGACCAGTTGCTACA
>probe:Drosophila_2:1628309_at:711:29; Interrogation_Position=1230; Antisense; ATACAGCTTCGAACGCTTCAATGCC
>probe:Drosophila_2:1628309_at:540:233; Interrogation_Position=1249; Antisense; AATGCCCACTTCAAACGATATGCCT
>probe:Drosophila_2:1628309_at:483:457; Interrogation_Position=1265; Antisense; GATATGCCTTCTACGGACCAATGGT
>probe:Drosophila_2:1628309_at:151:415; Interrogation_Position=1280; Antisense; GACCAATGGTATGCATGCACTTCCT
>probe:Drosophila_2:1628309_at:621:645; Interrogation_Position=1352; Antisense; TCTTCGAGACGGATATGCACGGCCC
>probe:Drosophila_2:1628309_at:571:467; Interrogation_Position=1389; Antisense; GTTGTCCTTGGACATCGCTGGCGAT
>probe:Drosophila_2:1628309_at:600:423; Interrogation_Position=1426; Antisense; GAGATCTTCAAGACCGTTCGTCACG
>probe:Drosophila_2:1628309_at:213:715; Interrogation_Position=1442; Antisense; TTCGTCACGCCTATGAGCATGGCTA
>probe:Drosophila_2:1628309_at:196:461; Interrogation_Position=1476; Antisense; GATTTAGATTCCCTTGCACAATTCC
>probe:Drosophila_2:1628309_at:131:165; Interrogation_Position=1641; Antisense; AAATGCCCCTATATTCAAGCGGAAT

Paste this into a BLAST search page for me
AGATCTACGCCGACTTGTTGCGCAAGTTGCGCAAGTACCATCGAAGCATGATGTTGGAACTGGTTCTGCGCCGAAACGATCGGGTGGACCAGTTGCTACAATACAGCTTCGAACGCTTCAATGCCAATGCCCACTTCAAACGATATGCCTGATATGCCTTCTACGGACCAATGGTGACCAATGGTATGCATGCACTTCCTTCTTCGAGACGGATATGCACGGCCCGTTGTCCTTGGACATCGCTGGCGATGAGATCTTCAAGACCGTTCGTCACGTTCGTCACGCCTATGAGCATGGCTAGATTTAGATTCCCTTGCACAATTCCAAATGCCCCTATATTCAAGCGGAAT

Full Affymetrix probeset data:

Annotations for 1628309_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime