FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628311_at:

>probe:Drosophila_2:1628311_at:30:617; Interrogation_Position=338; Antisense; TGCAGAACGCCTACGAATCGCCATT
>probe:Drosophila_2:1628311_at:28:379; Interrogation_Position=411; Antisense; GAAGCTGTACATAGACATCCTGATT
>probe:Drosophila_2:1628311_at:49:307; Interrogation_Position=429; Antisense; CCTGATTCTGGAGTGTGGCGGCAAT
>probe:Drosophila_2:1628311_at:56:523; Interrogation_Position=443; Antisense; GTGGCGGCAATCTACACGACGCAGT
>probe:Drosophila_2:1628311_at:634:173; Interrogation_Position=481; Antisense; AAAGCGGCTCTGTTCAACACAAAGC
>probe:Drosophila_2:1628311_at:472:511; Interrogation_Position=514; Antisense; GTGACAGCCACCATGTTGGATGCCG
>probe:Drosophila_2:1628311_at:414:103; Interrogation_Position=546; Antisense; AGACCTCATCATATCGGACAATCCG
>probe:Drosophila_2:1628311_at:125:101; Interrogation_Position=596; Antisense; AGACGGTTCCGCTGTTGGTCACAGT
>probe:Drosophila_2:1628311_at:179:15; Interrogation_Position=635; Antisense; ATTATGTCCTGGTGGATCCTTCGGC
>probe:Drosophila_2:1628311_at:688:541; Interrogation_Position=690; Antisense; GGTTGTGTCAGTTTCCATGCGGAAT
>probe:Drosophila_2:1628311_at:712:227; Interrogation_Position=712; Antisense; AATGGACAGGCATTCCTTTCGGGTA
>probe:Drosophila_2:1628311_at:380:1; Interrogation_Position=728; Antisense; TTTCGGGTACACACTTGACCGGCGG
>probe:Drosophila_2:1628311_at:228:255; Interrogation_Position=780; Antisense; CAACTGTCTGGAGCTGGGTCTGGCC
>probe:Drosophila_2:1628311_at:423:555; Interrogation_Position=819; Antisense; GGACCGGCTGCTCACTAAAATGCTA

Paste this into a BLAST search page for me
TGCAGAACGCCTACGAATCGCCATTGAAGCTGTACATAGACATCCTGATTCCTGATTCTGGAGTGTGGCGGCAATGTGGCGGCAATCTACACGACGCAGTAAAGCGGCTCTGTTCAACACAAAGCGTGACAGCCACCATGTTGGATGCCGAGACCTCATCATATCGGACAATCCGAGACGGTTCCGCTGTTGGTCACAGTATTATGTCCTGGTGGATCCTTCGGCGGTTGTGTCAGTTTCCATGCGGAATAATGGACAGGCATTCCTTTCGGGTATTTCGGGTACACACTTGACCGGCGGCAACTGTCTGGAGCTGGGTCTGGCCGGACCGGCTGCTCACTAAAATGCTA

Full Affymetrix probeset data:

Annotations for 1628311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720