FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628313_at:

>probe:Drosophila_2:1628313_at:335:21; Interrogation_Position=427; Antisense; ATATCTTCCAAAACTCACAGTGCTG
>probe:Drosophila_2:1628313_at:617:153; Interrogation_Position=443; Antisense; ACAGTGCTGGCCACATCGCATTGGA
>probe:Drosophila_2:1628313_at:632:633; Interrogation_Position=458; Antisense; TCGCATTGGATCATGTCTGGTCATT
>probe:Drosophila_2:1628313_at:722:33; Interrogation_Position=495; Antisense; ATCAGACGATCGCACTCGGGATAGT
>probe:Drosophila_2:1628313_at:496:639; Interrogation_Position=510; Antisense; TCGGGATAGTCAACGGAGCCATGTT
>probe:Drosophila_2:1628313_at:514:101; Interrogation_Position=526; Antisense; AGCCATGTTGGCCTTTTACAGACCT
>probe:Drosophila_2:1628313_at:156:701; Interrogation_Position=539; Antisense; TTTTACAGACCTTTTGGCGCGGGCT
>probe:Drosophila_2:1628313_at:57:267; Interrogation_Position=569; Antisense; CTAAGGAAAGCACCTCCGGATTTGA
>probe:Drosophila_2:1628313_at:5:425; Interrogation_Position=617; Antisense; GAGACTGTACACTCAACGTCAGACG
>probe:Drosophila_2:1628313_at:364:125; Interrogation_Position=690; Antisense; AGCCGTCCGTGTCAATTCAATTGCA
>probe:Drosophila_2:1628313_at:691:241; Interrogation_Position=800; Antisense; AATATGGTGCCTTCTATAACACGGG
>probe:Drosophila_2:1628313_at:84:379; Interrogation_Position=825; Antisense; GAAGCTCCATTGAGTCTCCGCAGAG
>probe:Drosophila_2:1628313_at:181:363; Interrogation_Position=877; Antisense; GAATTTTCTTAATGTAACCAGCTGG
>probe:Drosophila_2:1628313_at:100:423; Interrogation_Position=911; Antisense; GGTAATTCAACGATGGTCCCATCCC

Paste this into a BLAST search page for me
ATATCTTCCAAAACTCACAGTGCTGACAGTGCTGGCCACATCGCATTGGATCGCATTGGATCATGTCTGGTCATTATCAGACGATCGCACTCGGGATAGTTCGGGATAGTCAACGGAGCCATGTTAGCCATGTTGGCCTTTTACAGACCTTTTTACAGACCTTTTGGCGCGGGCTCTAAGGAAAGCACCTCCGGATTTGAGAGACTGTACACTCAACGTCAGACGAGCCGTCCGTGTCAATTCAATTGCAAATATGGTGCCTTCTATAACACGGGGAAGCTCCATTGAGTCTCCGCAGAGGAATTTTCTTAATGTAACCAGCTGGGGTAATTCAACGATGGTCCCATCCC

Full Affymetrix probeset data:

Annotations for 1628313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720