Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628314_a_at:

>probe:Drosophila_2:1628314_a_at:64:577; Interrogation_Position=420; Antisense; TGGCCACGTCGCTGGAGAAGGACTC
>probe:Drosophila_2:1628314_a_at:277:371; Interrogation_Position=436; Antisense; GAAGGACTCGATTCGCGAGGCCTAC
>probe:Drosophila_2:1628314_a_at:115:71; Interrogation_Position=453; Antisense; AGGCCTACGAGGATGTACGCTCCGA
>probe:Drosophila_2:1628314_a_at:158:443; Interrogation_Position=464; Antisense; GATGTACGCTCCGATCTGACAGACA
>probe:Drosophila_2:1628314_a_at:8:155; Interrogation_Position=482; Antisense; ACAGACACCGAGTGGGCGGTATTCA
>probe:Drosophila_2:1628314_a_at:375:539; Interrogation_Position=499; Antisense; GGTATTCAAGTTCGATGGCGCCCAG
>probe:Drosophila_2:1628314_a_at:28:441; Interrogation_Position=512; Antisense; GATGGCGCCCAGATTATTGTACATG
>probe:Drosophila_2:1628314_a_at:428:95; Interrogation_Position=522; Antisense; AGATTATTGTACATGCGCGCGGTCA
>probe:Drosophila_2:1628314_a_at:658:297; Interrogation_Position=537; Antisense; CGCGCGGTCAGTGCTTTGAGGAATT
>probe:Drosophila_2:1628314_a_at:54:363; Interrogation_Position=557; Antisense; GAATTCCGACAGCAGTTCGGCGACT
>probe:Drosophila_2:1628314_a_at:600:275; Interrogation_Position=592; Antisense; CTTTGGCTACATACGCATCCAGATG
>probe:Drosophila_2:1628314_a_at:604:329; Interrogation_Position=816; Antisense; GCGGCGCCAACTACGGAACGGGCAT
>probe:Drosophila_2:1628314_a_at:230:271; Interrogation_Position=842; Antisense; CGGGATAACTAAGCGGCCTCCAAGT
>probe:Drosophila_2:1628314_a_at:5:693; Interrogation_Position=888; Antisense; TTTGCAACTCTTAACTGCTTACCAA

Paste this into a BLAST search page for me
TGGCCACGTCGCTGGAGAAGGACTCGAAGGACTCGATTCGCGAGGCCTACAGGCCTACGAGGATGTACGCTCCGAGATGTACGCTCCGATCTGACAGACAACAGACACCGAGTGGGCGGTATTCAGGTATTCAAGTTCGATGGCGCCCAGGATGGCGCCCAGATTATTGTACATGAGATTATTGTACATGCGCGCGGTCACGCGCGGTCAGTGCTTTGAGGAATTGAATTCCGACAGCAGTTCGGCGACTCTTTGGCTACATACGCATCCAGATGGCGGCGCCAACTACGGAACGGGCATCGGGATAACTAAGCGGCCTCCAAGTTTTGCAACTCTTAACTGCTTACCAA

Full Affymetrix probeset data:

Annotations for 1628314_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime