Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628315_at:

>probe:Drosophila_2:1628315_at:291:369; Interrogation_Position=2154; Antisense; GAATGCCATCGATTTGCCGCTGAAG
>probe:Drosophila_2:1628315_at:321:711; Interrogation_Position=2206; Antisense; TTCAGCACCTGCTCTGACCGGATTA
>probe:Drosophila_2:1628315_at:444:411; Interrogation_Position=2221; Antisense; GACCGGATTACAATGCCTTGCATCA
>probe:Drosophila_2:1628315_at:498:459; Interrogation_Position=2251; Antisense; GATTTCATAGGAACCGGTCTGGGCC
>probe:Drosophila_2:1628315_at:314:517; Interrogation_Position=2329; Antisense; GTGTGGCCCTGTCGCATTGAAAGCA
>probe:Drosophila_2:1628315_at:218:393; Interrogation_Position=2347; Antisense; GAAAGCACTGTGACTCCGTTCTATA
>probe:Drosophila_2:1628315_at:378:145; Interrogation_Position=2359; Antisense; ACTCCGTTCTATATTGGTGTCCACT
>probe:Drosophila_2:1628315_at:114:593; Interrogation_Position=2373; Antisense; TGGTGTCCACTTCGGCAATGGCCAG
>probe:Drosophila_2:1628315_at:709:659; Interrogation_Position=2424; Antisense; TAACGTGGGTGCCTGTCTGCGATAT
>probe:Drosophila_2:1628315_at:535:623; Interrogation_Position=2441; Antisense; TGCGATATTCCCAAGTGCAATGCAT
>probe:Drosophila_2:1628315_at:64:531; Interrogation_Position=2479; Antisense; GGGATATTAACTTTCATTTCGCTTT
>probe:Drosophila_2:1628315_at:705:465; Interrogation_Position=2584; Antisense; GTTGATAGTAACATTCCCTGGATAA
>probe:Drosophila_2:1628315_at:90:123; Interrogation_Position=2683; Antisense; AGCGACTTTTACAGCTTTCAATAAA
>probe:Drosophila_2:1628315_at:183:499; Interrogation_Position=2709; Antisense; GTCTATGTGAGTTGTTCGCTTGCTT

Paste this into a BLAST search page for me
GAATGCCATCGATTTGCCGCTGAAGTTCAGCACCTGCTCTGACCGGATTAGACCGGATTACAATGCCTTGCATCAGATTTCATAGGAACCGGTCTGGGCCGTGTGGCCCTGTCGCATTGAAAGCAGAAAGCACTGTGACTCCGTTCTATAACTCCGTTCTATATTGGTGTCCACTTGGTGTCCACTTCGGCAATGGCCAGTAACGTGGGTGCCTGTCTGCGATATTGCGATATTCCCAAGTGCAATGCATGGGATATTAACTTTCATTTCGCTTTGTTGATAGTAACATTCCCTGGATAAAGCGACTTTTACAGCTTTCAATAAAGTCTATGTGAGTTGTTCGCTTGCTT

Full Affymetrix probeset data:

Annotations for 1628315_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime