FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628316_at:

>probe:Drosophila_2:1628316_at:580:159; Interrogation_Position=1034; Antisense; AAAAGAACGGAGATGCTGCCTTTAA
>probe:Drosophila_2:1628316_at:257:529; Interrogation_Position=1074; Antisense; GGGAGAGACATTTCTGACCAAGATC
>probe:Drosophila_2:1628316_at:302:435; Interrogation_Position=1102; Antisense; GAGGTGACTCTGTAAGCTTTTCTTT
>probe:Drosophila_2:1628316_at:717:679; Interrogation_Position=1138; Antisense; TATGCCATCTAATTCCTTTTACCTG
>probe:Drosophila_2:1628316_at:615:313; Interrogation_Position=1176; Antisense; GCCTTCTTTCATTTATTTTCGGGAG
>probe:Drosophila_2:1628316_at:562:709; Interrogation_Position=1212; Antisense; TTAATTTGTTACCAACGTGCTGCAA
>probe:Drosophila_2:1628316_at:543:1; Interrogation_Position=1339; Antisense; ATGCATTGACTTTGATCGGAACGAA
>probe:Drosophila_2:1628316_at:230:113; Interrogation_Position=1441; Antisense; AGCTTTTTACACTTTTCAACTTGCA
>probe:Drosophila_2:1628316_at:393:361; Interrogation_Position=899; Antisense; GCAAGTGGCATGTCATTCCGCTGGA
>probe:Drosophila_2:1628316_at:366:421; Interrogation_Position=925; Antisense; GAGAATCAACTAATGTACGCCGCCA
>probe:Drosophila_2:1628316_at:701:669; Interrogation_Position=940; Antisense; TACGCCGCCATCGATGTCTATATTG
>probe:Drosophila_2:1628316_at:496:687; Interrogation_Position=958; Antisense; TATATTGGTCAGGTTATCTATCGTG
>probe:Drosophila_2:1628316_at:159:39; Interrogation_Position=973; Antisense; ATCTATCGTGAATTGGAACGCCGCG
>probe:Drosophila_2:1628316_at:410:381; Interrogation_Position=988; Antisense; GAACGCCGCGAGAAGGTCAAGATTA

Paste this into a BLAST search page for me
AAAAGAACGGAGATGCTGCCTTTAAGGGAGAGACATTTCTGACCAAGATCGAGGTGACTCTGTAAGCTTTTCTTTTATGCCATCTAATTCCTTTTACCTGGCCTTCTTTCATTTATTTTCGGGAGTTAATTTGTTACCAACGTGCTGCAAATGCATTGACTTTGATCGGAACGAAAGCTTTTTACACTTTTCAACTTGCAGCAAGTGGCATGTCATTCCGCTGGAGAGAATCAACTAATGTACGCCGCCATACGCCGCCATCGATGTCTATATTGTATATTGGTCAGGTTATCTATCGTGATCTATCGTGAATTGGAACGCCGCGGAACGCCGCGAGAAGGTCAAGATTA

Full Affymetrix probeset data:

Annotations for 1628316_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720